BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2306429.2.4
(806 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AI999258.1|AI999258 701555179 A. thaliana, Columbia Col-... 48 0.002
gb|BX836430.1|BX836430 BX836430 Arabidopsis thaliana Siliqu... 48 0.002
gb|BP789533.1|BP789533 BP789533 RAFL7 Arabidopsis thaliana ... 48 0.002
gb|BP814594.1|BP814594 BP814594 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP821120.1|BP821120 BP821120 RAFL19 Arabidopsis thaliana... 48 0.002
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 48 0.002
emb|AL035527.1|ATF17L22 Arabidopsis thaliana DNA chromosome... 48 0.002
emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosom... 48 0.002
dbj|AK220972.1| Arabidopsis thaliana mRNA for hypothetical ... 48 0.002
ref|NM_118296.3| Arabidopsis thaliana hydrolase, hydrolyzin... 48 0.002
ref|NM_118297.3| Arabidopsis thaliana RNA binding / pseudou... 48 0.002
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 48 0.002
>gb|AI999258.1|AI999258 701555179 A. thaliana, Columbia Col-0, rosette-3 Arabidopsis
thaliana cDNA clone 701555179, mRNA sequence
Length = 613
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 290 tacttcgcctggtctttactagacaacttcgagtgg 255
>gb|BX836430.1|BX836430 BX836430 Arabidopsis thaliana Silique Col-0 Arabidopsis thaliana
cDNA clone GSLTSIL83ZH06 3PRIM, mRNA sequence
Length = 593
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 50 tacttcgcctggtctttactagacaacttcgagtgg 85
>gb|BP789533.1|BP789533 BP789533 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-39-G17 3',
mRNA sequence
Length = 421
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 101 tacttcgcctggtctttactagacaacttcgagtgg 136
>gb|BP814594.1|BP814594 BP814594 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-36-D19 5',
mRNA sequence
Length = 379
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 216 tacttcgcctggtctttactagacaacttcgagtgg 181
>gb|BP821120.1|BP821120 BP821120 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-56-O12 5',
mRNA sequence
Length = 391
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 218 tacttcgcctggtctttactagacaacttcgagtgg 183
>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
Length = 14497843
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 7476427 tacttcgcctggtctttactagacaacttcgagtgg 7476462
>emb|AL035527.1|ATF17L22 Arabidopsis thaliana DNA chromosome 4, BAC clone F17L22 (ESSAII
project)
Length = 107702
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 95471 tacttcgcctggtctttactagacaacttcgagtgg 95506
>emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 55
Length = 194916
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 181529 tacttcgcctggtctttactagacaacttcgagtgg 181564
>dbj|AK220972.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds,
clone: RAFL22-56-O12
Length = 372
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 217 tacttcgcctggtctttactagacaacttcgagtgg 182
>ref|NM_118296.3| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT4G21760 mRNA, complete cds
Length = 1687
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 1399 tacttcgcctggtctttactagacaacttcgagtgg 1434
>ref|NM_118297.3| Arabidopsis thaliana RNA binding / pseudouridine synthase/
pseudouridylate synthase AT4G21770 mRNA, complete cds
Length = 1693
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 1644 tacttcgcctggtctttactagacaacttcgagtgg 1609
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 345 tacttcgcctggtctctcctcgacaacttcgagtgg 380
||||||||||||||| | || |||||||||||||||
Sbjct: 11563674 tacttcgcctggtctttactagacaacttcgagtgg 11563709
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 284,607
Number of Sequences: 1013581
Number of extensions: 284607
Number of successful extensions: 21512
Number of sequences better than 0.5: 12
Number of HSP's better than 0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 21308
Number of HSP's gapped (non-prelim): 204
length of query: 806
length of database: 908,940,872
effective HSP length: 20
effective length of query: 786
effective length of database: 888,669,252
effective search space: 698494032072
effective search space used: 698494032072
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)