BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2276425.2.1
(753 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|B27849.1|B27849 T19D7TFB TAMU Arabidopsis thaliana genom... 54 4e-005
gb|BH170317.1|BH170317 SALK_002706 Arabidopsis thaliana TDN... 54 4e-005
gb|BZ353022.1|BZ353022 SALK_119658.47.35.x Arabidopsis thal... 54 4e-005
gb|AU237748.1|AU237748 AU237748 RAFL16 Arabidopsis thaliana... 54 4e-005
gb|AF424587.1|AF424587 Arabidopsis thaliana AT3g62720/F26K9... 54 4e-005
gb|BT002298.1| Arabidopsis thaliana At3g62720/F26K9_150 mRN... 54 4e-005
emb|BX824096.1|CNS0A4OA Arabidopsis thaliana Full-length cD... 54 4e-005
emb|BX823597.1|CNS0A5AZ Arabidopsis thaliana Full-length cD... 54 4e-005
emb|BX816605.1|CNS0AD3T Arabidopsis thaliana Full-length cD... 54 4e-005
emb|CQ804896.1| Sequence 1307 from Patent WO2004035798 54 4e-005
dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complet... 54 4e-005
emb|AL162651.1|ATF26K9 Arabidopsis thaliana DNA chromosome ... 54 4e-005
ref|NM_116137.2| Arabidopsis thaliana transferase/ transfer... 54 4e-005
ref|NM_001035840.1| Arabidopsis thaliana transferase/ trans... 54 4e-005
ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complet... 54 4e-005
emb|BX823553.1|CNS0A7KJ Arabidopsis thaliana Full-length cD... 52 1e-004
gb|AV805008.1|AV805008 AV805008 RAFL9 Arabidopsis thaliana ... 48 0.002
gb|BX834253.1|BX834253 BX834253 Arabidopsis thaliana Adult ... 48 0.002
gb|BP665076.1|BP665076 BP665076 RAFL21 Arabidopsis thaliana... 48 0.002
gb|BP797816.1|BP797816 BP797816 RAFL14 Arabidopsis thaliana... 48 0.002
emb|AJ245571.1|ATH245571 Arabidopsis thaliana mRNA for puta... 48 0.002
gb|AY057598.1| Arabidopsis thaliana AT4g02500/T10P11_20 mRN... 48 0.002
gb|AY140029.1| Arabidopsis thaliana putative glycosyltransf... 48 0.002
gb|BT006601.1| Arabidopsis thaliana At4g02500 mRNA, complet... 48 0.002
emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, shor... 48 0.002
gb|AF069298.1|T14P8 Arabidopsis thaliana BAC T14P8 48 0.002
emb|AL161494.2|ATCHRIV6 Arabidopsis thaliana DNA chromosome... 48 0.002
gb|AC002330.1| Arabidopsis thaliana BAC T10P11 from chromos... 48 0.002
ref|NM_116484.2| Arabidopsis thaliana transferase/ transfer... 48 0.002
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 48 0.002
>gb|B27849.1|B27849 T19D7TFB TAMU Arabidopsis thaliana genomic clone T19D7, DNA
sequence
Length = 599
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 324 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 274
>gb|BH170317.1|BH170317 SALK_002706 Arabidopsis thaliana TDNA insertion lines Arabidopsis
thaliana genomic clone SALK_002706, DNA sequence
Length = 308
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 177 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 127
>gb|BZ353022.1|BZ353022 SALK_119658.47.35.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_119658.47.35.x,
DNA sequence
Length = 367
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 39 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 89
>gb|AU237748.1|AU237748 AU237748 RAFL16 Arabidopsis thaliana cDNA clone RAFL16-54-E06 5',
mRNA sequence
Length = 604
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 350 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 300
>gb|AF424587.1|AF424587 Arabidopsis thaliana AT3g62720/F26K9_150 mRNA, complete cds
Length = 1763
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 1246 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 1296
>gb|BT002298.1| Arabidopsis thaliana At3g62720/F26K9_150 mRNA, complete cds
Length = 1383
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 1036 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 1086
>emb|BX824096.1|CNS0A4OA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH22ZA11 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1696
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 1162 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 1212
>emb|BX823597.1|CNS0A5AZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS55ZD09 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1562
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 1073 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 1123
>emb|BX816605.1|CNS0AD3T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTPGH58ZF02 of Hormone Treated Callus of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1489
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 373 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 323
>emb|CQ804896.1| Sequence 1307 from Patent WO2004035798
Length = 1383
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 1036 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 1086
>dbj|BA000014.8| Arabidopsis thaliana, chromosome 3, complete sequence
Length = 23403063
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 23145593 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 23145643
>emb|AL162651.1|ATF26K9 Arabidopsis thaliana DNA chromosome 3, BAC clone F26K9
Length = 110257
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 55336 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 55386
>ref|NM_116137.2| Arabidopsis thaliana transferase/ transferase, transferring glycosyl
groups AT3G62720 transcript variant AT3G62720.1 mRNA,
complete cds
Length = 1791
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 1245 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 1295
>ref|NM_001035840.1| Arabidopsis thaliana transferase/ transferase, transferring glycosyl
groups AT3G62720 transcript variant AT3G62720.2 mRNA,
complete cds
Length = 1660
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 1108 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 1158
>ref|NC_003074.4| Arabidopsis thaliana chromosome 3, complete sequence
Length = 23470805
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 71 cacggctactgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
||||| || |||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 23213337 cacggttattgggggattttggtagaccggtacgaggagatgattgagaat 23213387
>emb|BX823553.1|CNS0A7KJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS50ZD06 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 1545
Score = 52.0 bits (26), Expect = 1e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 80 tgggggatcttggtcgacaggtacgaggagatgcttgagaat 121
|||||||| ||||| ||| |||||||||||||| ||||||||
Sbjct: 1100 tgggggattttggtagaccggtacgaggagatgattgagaat 1141
>gb|AV805008.1|AV805008 AV805008 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-41-F24 3',
mRNA sequence
Length = 406
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 385 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 342
>gb|BX834253.1|BX834253 BX834253 Arabidopsis thaliana Adult vegetative tissue Col-0
Arabidopsis thaliana cDNA clone GSLTLS20ZC05 3PRIM, mRNA
sequence
Length = 789
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 476 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 433
>gb|BP665076.1|BP665076 BP665076 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-15-A09 3',
mRNA sequence
Length = 414
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 384 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 341
>gb|BP797816.1|BP797816 BP797816 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-04-P12 5',
mRNA sequence
Length = 377
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 221 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 264
>emb|AJ245571.1|ATH245571 Arabidopsis thaliana mRNA for putative golgi glycosyltransferase,
(gt15 gene)
Length = 1470
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 1213 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 1256
>gb|AY057598.1| Arabidopsis thaliana AT4g02500/T10P11_20 mRNA, complete cds
Length = 1581
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 1147 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 1190
>gb|AY140029.1| Arabidopsis thaliana putative glycosyltransferase (At4g02500) mRNA,
complete cds
Length = 1782
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 1263 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 1306
>gb|BT006601.1| Arabidopsis thaliana At4g02500 mRNA, complete cds
Length = 1386
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 1132 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 1175
>emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, short arm
Length = 3052119
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 1101902 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 1101945
>gb|AF069298.1|T14P8 Arabidopsis thaliana BAC T14P8
Length = 94536
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 7873 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 7830
>emb|AL161494.2|ATCHRIV6 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 6
Length = 194892
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 138742 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 138785
>gb|AC002330.1| Arabidopsis thaliana BAC T10P11 from chromosome IV, near 15 cM, complete
sequence
Length = 113566
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 108003 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 107960
>ref|NM_116484.2| Arabidopsis thaliana transferase/ transferase, transferring glycosyl
groups AT4G02500 mRNA, complete cds
Length = 1782
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 1263 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 1306
>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
Length = 18585042
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 164 cactttgtcgggtgcaagccgtgtggcaaatttggagactaccc 207
||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 1103091 cactttgtcggttgcaaaccgtgtgggaaatttggtgattaccc 1103134
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 387,317
Number of Sequences: 1013581
Number of extensions: 387317
Number of successful extensions: 27886
Number of sequences better than 0.5: 30
Number of HSP's better than 0.5 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27246
Number of HSP's gapped (non-prelim): 640
length of query: 753
length of database: 908,940,872
effective HSP length: 20
effective length of query: 733
effective length of database: 888,669,252
effective search space: 651394561716
effective search space used: 651394561716
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)