BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2192890.2.1
         (531 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|BX658738.1|  Arabidopsis thaliana T-DNA flanking sequenc...    40   0.37 
gb|AC004393.2|T1F15  Arabidopsis thaliana chromosome 1 BAC T...    40   0.37 
gb|AE005173.1|  Arabidopsis thaliana chromosome 1, bottom ar...    40   0.37 
ref|NC_003070.5|  Arabidopsis thaliana chromosome 1, complet...    40   0.37 

>emb|BX658738.1| Arabidopsis thaliana T-DNA flanking sequence GK-639B10-022274,
           genomic survey sequence
          Length = 309

 Score = 40.1 bits (20), Expect = 0.37
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 457 ttgatttgatgggttattaatatt 480
           |||||||||||| |||||||||||
Sbjct: 162 ttgatttgatggcttattaatatt 185



>gb|AC004393.2|T1F15 Arabidopsis thaliana chromosome 1 BAC T1F15 sequence, complete sequence
          Length = 60066

 Score = 40.1 bits (20), Expect = 0.37
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 457   ttgatttgatgggttattaatatt 480
             |||||||||||| |||||||||||
Sbjct: 41470 ttgatttgatggcttattaatatt 41447



>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
          Length = 14668883

 Score = 40.1 bits (20), Expect = 0.37
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 457     ttgatttgatgggttattaatatt 480
               |||||||||||| |||||||||||
Sbjct: 9507233 ttgatttgatggcttattaatatt 9507256



>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
          Length = 30432563

 Score = 40.1 bits (20), Expect = 0.37
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 457      ttgatttgatgggttattaatatt 480
                |||||||||||| |||||||||||
Sbjct: 25269581 ttgatttgatggcttattaatatt 25269604



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 283,611
Number of Sequences: 1013581
Number of extensions: 283611
Number of successful extensions: 21030
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20758
Number of HSP's gapped (non-prelim): 272
length of query: 531
length of database: 908,940,872
effective HSP length: 20
effective length of query: 511
effective length of database: 888,669,252
effective search space: 454109987772
effective search space used: 454109987772
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)