BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2192890.2.1
(531 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|BX658738.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.37
gb|AC004393.2|T1F15 Arabidopsis thaliana chromosome 1 BAC T... 40 0.37
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 40 0.37
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 40 0.37
>emb|BX658738.1| Arabidopsis thaliana T-DNA flanking sequence GK-639B10-022274,
genomic survey sequence
Length = 309
Score = 40.1 bits (20), Expect = 0.37
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 457 ttgatttgatgggttattaatatt 480
|||||||||||| |||||||||||
Sbjct: 162 ttgatttgatggcttattaatatt 185
>gb|AC004393.2|T1F15 Arabidopsis thaliana chromosome 1 BAC T1F15 sequence, complete sequence
Length = 60066
Score = 40.1 bits (20), Expect = 0.37
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 457 ttgatttgatgggttattaatatt 480
|||||||||||| |||||||||||
Sbjct: 41470 ttgatttgatggcttattaatatt 41447
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 40.1 bits (20), Expect = 0.37
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 457 ttgatttgatgggttattaatatt 480
|||||||||||| |||||||||||
Sbjct: 9507233 ttgatttgatggcttattaatatt 9507256
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 40.1 bits (20), Expect = 0.37
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 457 ttgatttgatgggttattaatatt 480
|||||||||||| |||||||||||
Sbjct: 25269581 ttgatttgatggcttattaatatt 25269604
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 283,611
Number of Sequences: 1013581
Number of extensions: 283611
Number of successful extensions: 21030
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20758
Number of HSP's gapped (non-prelim): 272
length of query: 531
length of database: 908,940,872
effective HSP length: 20
effective length of query: 511
effective length of database: 888,669,252
effective search space: 454109987772
effective search space used: 454109987772
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)