BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2192679.2.1
         (1274 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|AL756318.1|  Arabidopsis thaliana T-DNA flanking sequenc...    44   0.059
emb|AL756320.1|  Arabidopsis thaliana T-DNA flanking sequenc...    44   0.059
gb|AC027034.10|AC027034  Arabidopsis thaliana chromosome 1 B...    44   0.059
gb|AE005173.1|  Arabidopsis thaliana chromosome 1, bottom ar...    44   0.059
ref|NC_003070.5|  Arabidopsis thaliana chromosome 1, complet...    44   0.059

>emb|AL756318.1| Arabidopsis thaliana T-DNA flanking sequence GK-107H10-012498,
           genomic survey sequence
          Length = 507

 Score = 44.1 bits (22), Expect = 0.059
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 598 aatcagttcttctatgggagtg 619
           ||||||||||||||||||||||
Sbjct: 286 aatcagttcttctatgggagtg 265



>emb|AL756320.1| Arabidopsis thaliana T-DNA flanking sequence GK-107H11-012498,
           genomic survey sequence
          Length = 381

 Score = 44.1 bits (22), Expect = 0.059
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 598 aatcagttcttctatgggagtg 619
           ||||||||||||||||||||||
Sbjct: 160 aatcagttcttctatgggagtg 139



>gb|AC027034.10|AC027034 Arabidopsis thaliana chromosome 1 BAC F7A10 genomic sequence, complete
             sequence
          Length = 101954

 Score = 44.1 bits (22), Expect = 0.059
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 598   aatcagttcttctatgggagtg 619
             ||||||||||||||||||||||
Sbjct: 78519 aatcagttcttctatgggagtg 78540



>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
          Length = 14668883

 Score = 44.1 bits (22), Expect = 0.059
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 598     aatcagttcttctatgggagtg 619
               ||||||||||||||||||||||
Sbjct: 4959335 aatcagttcttctatgggagtg 4959314



>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
          Length = 30432563

 Score = 44.1 bits (22), Expect = 0.059
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 598      aatcagttcttctatgggagtg 619
                ||||||||||||||||||||||
Sbjct: 20603569 aatcagttcttctatgggagtg 20603548



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 584,988
Number of Sequences: 1013581
Number of extensions: 584988
Number of successful extensions: 41742
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41241
Number of HSP's gapped (non-prelim): 501
length of query: 1274
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1254
effective length of database: 888,669,252
effective search space: 1114391242008
effective search space used: 1114391242008
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)