BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2188214.2.1
         (880 letters)

Database: At_nucl_with_EST.fasta 
           1,013,581 sequences; 908,940,872 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|AL942357.1|  Arabidopsis thaliana T-DNA flanking sequenc...    42   0.16 
emb|AJ270060.1|  Arabidopsis thaliana DNA chromosome 4, long...    42   0.16 
emb|AL161542.2|ATCHRIV42  Arabidopsis thaliana DNA chromosom...    42   0.16 
emb|Z97339.2|ATFCA4  Arabidopsis thaliana DNA chromosome 4, ...    42   0.16 
ref|NC_003075.3|  Arabidopsis thaliana chromosome 4, complet...    42   0.16 

>emb|AL942357.1| Arabidopsis thaliana T-DNA flanking sequence GK-265D01-014990,
           genomic survey sequence
          Length = 375

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 589 gggtgttgtatgacttgcaattctg 613
           ||||||||||||||||||| |||||
Sbjct: 143 gggtgttgtatgacttgcatttctg 119



>emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long arm
          Length = 14497843

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 589     gggtgttgtatgacttgcaattctg 613
               ||||||||||||||||||| |||||
Sbjct: 4806508 gggtgttgtatgacttgcatttctg 4806532



>emb|AL161542.2|ATCHRIV42 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 42
          Length = 195068

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 589   gggtgttgtatgacttgcaattctg 613
             ||||||||||||||||||| |||||
Sbjct: 19466 gggtgttgtatgacttgcatttctg 19490



>emb|Z97339.2|ATFCA4 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 4
          Length = 205065

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 589   gggtgttgtatgacttgcaattctg 613
             ||||||||||||||||||| |||||
Sbjct: 62412 gggtgttgtatgacttgcatttctg 62436



>ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complete sequence
          Length = 18585042

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 589     gggtgttgtatgacttgcaattctg 613
               ||||||||||||||||||| |||||
Sbjct: 8893765 gggtgttgtatgacttgcatttctg 8893789



  Database: At_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:09 PM
  Number of letters in database: 908,940,872
  Number of sequences in database:  1,013,581
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 333,980
Number of Sequences: 1013581
Number of extensions: 333980
Number of successful extensions: 26241
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25931
Number of HSP's gapped (non-prelim): 310
length of query: 880
length of database: 908,940,872
effective HSP length: 20
effective length of query: 860
effective length of database: 888,669,252
effective search space: 764255556720
effective search space used: 764255556720
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)