BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2161272.2.15
(797 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CC883891.1|CC883891 SALK_102079.56.00.x Arabidopsis thal... 42 0.14
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 42 0.14
gb|AC013354.6|AC013354 Genomic sequence for Arabidopsis tha... 42 0.14
gb|AC006282.4| Arabidopsis thaliana chromosome 2 clone F13K... 42 0.14
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 42 0.14
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 42 0.14
>gb|CC883891.1|CC883891 SALK_102079.56.00.x Arabidopsis thaliana TDNA insertion lines
Arabidopsis thaliana genomic clone SALK_102079.56.00.x,
DNA sequence
Length = 133
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 731 aaattatataattttcatata 751
|||||||||||||||||||||
Sbjct: 72 aaattatataattttcatata 92
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 734 ttatataattttcatatacta 754
|||||||||||||||||||||
Sbjct: 6314692 ttatataattttcatatacta 6314672
>gb|AC013354.6|AC013354 Genomic sequence for Arabidopsis thaliana BAC F15H18 from chromosome I,
complete sequence
Length = 95327
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 734 ttatataattttcatatacta 754
|||||||||||||||||||||
Sbjct: 61749 ttatataattttcatatacta 61769
>gb|AC006282.4| Arabidopsis thaliana chromosome 2 clone F13K3 map g6825, complete
sequence
Length = 92376
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 731 aaattatataattttcatata 751
|||||||||||||||||||||
Sbjct: 27914 aaattatataattttcatata 27894
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 731 aaattatataattttcatata 751
|||||||||||||||||||||
Sbjct: 15383621 aaattatataattttcatata 15383601
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 42.1 bits (21), Expect = 0.14
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 734 ttatataattttcatatacta 754
|||||||||||||||||||||
Sbjct: 6314868 ttatataattttcatatacta 6314848
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 246,341
Number of Sequences: 1013581
Number of extensions: 246341
Number of successful extensions: 17321
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16999
Number of HSP's gapped (non-prelim): 322
length of query: 797
length of database: 908,940,872
effective HSP length: 20
effective length of query: 777
effective length of database: 888,669,252
effective search space: 690496008804
effective search space used: 690496008804
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)