BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1804908.2.1
(1118 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CL506354.1|CL506354 SAIL_765_F11.v1 SAIL Collection Arab... 60 9e-007
gb|BP785598.1|BP785598 BP785598 RAFL7 Arabidopsis thaliana ... 60 9e-007
gb|BT010611.1| Arabidopsis thaliana At5g36890 gene, complet... 60 9e-007
dbj|AB016877.1| Arabidopsis thaliana genomic DNA, chromosom... 60 9e-007
dbj|AK175760.1| Arabidopsis thaliana mRNA for beta-glucosid... 60 9e-007
ref|NM_123047.2| Arabidopsis thaliana hydrolase, hydrolyzin... 60 9e-007
ref|NM_001036898.1| Arabidopsis thaliana hydrolase, hydroly... 60 9e-007
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 60 9e-007
gb|BP649344.1|BP649344 BP649344 RAFL19 Arabidopsis thaliana... 56 1e-005
gb|CL515693.1|CL515693 SAIL_903_F03.v1 SAIL Collection Arab... 54 5e-005
gb|B30352.1|B30352 F3C5TW IGF Arabidopsis thaliana genomic ... 42 0.20
emb|CT026173.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.20
emb|CT026174.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.20
emb|AX506308.1| Sequence 1003 from Patent WO0216655 42 0.20
gb|AC004521.3| Arabidopsis thaliana chromosome 2 clone F4I1... 42 0.20
emb|BX821615.1|CNS0A8A3 Arabidopsis thaliana Full-length cD... 42 0.20
emb|BX818939.1|CNS0A8X4 Arabidopsis thaliana Full-length cD... 42 0.20
ref|NM_130008.1| Arabidopsis thaliana hydrolase, hydrolyzin... 42 0.20
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 42 0.20
>gb|CL506354.1|CL506354 SAIL_765_F11.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_765_F11.v1, DNA sequence
Length = 939
Score = 60.0 bits (30), Expect = 9e-007
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 381 gcccactcgaagttgtccaggaacgaccacgcaaagta 418
|||||||||||||||||||| | |||||||||||||||
Sbjct: 416 gcccactcgaagttgtccagcagcgaccacgcaaagta 453
>gb|BP785598.1|BP785598 BP785598 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-95-I24 3',
mRNA sequence
Length = 406
Score = 60.0 bits (30), Expect = 9e-007
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 381 gcccactcgaagttgtccaggaacgaccacgcaaagta 418
|||||||||||||||||||| | |||||||||||||||
Sbjct: 305 gcccactcgaagttgtccagcagcgaccacgcaaagta 342
>gb|BT010611.1| Arabidopsis thaliana At5g36890 gene, complete cds
Length = 1473
Score = 60.0 bits (30), Expect = 9e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 381 gcccactcgaagttgtccaggaacgaccacgcaaagta 418
|||||||||||||||||||| | |||||||||||||||
Sbjct: 1337 gcccactcgaagttgtccagcagcgaccacgcaaagta 1300
Score = 42.1 bits (21), Expect = 0.20
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 898 accatccaagttgaaagtcaa 918
|||||||||||||||||||||
Sbjct: 814 accatccaagttgaaagtcaa 794
>dbj|AB016877.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MLF18
Length = 74842
Score = 60.0 bits (30), Expect = 9e-007
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 381 gcccactcgaagttgtccaggaacgaccacgcaaagta 418
|||||||||||||||||||| | |||||||||||||||
Sbjct: 2018 gcccactcgaagttgtccagcagcgaccacgcaaagta 2055
Score = 44.1 bits (22), Expect = 0.052
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 897 taccatccaagttgaaagtcaa 918
||||||||||||||||||||||
Sbjct: 3500 taccatccaagttgaaagtcaa 3521
>dbj|AK175760.1| Arabidopsis thaliana mRNA for beta-glucosidase -like protein,
complete cds, clone: RAFL22-32-D12
Length = 1760
Score = 60.0 bits (30), Expect = 9e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 381 gcccactcgaagttgtccaggaacgaccacgcaaagta 418
|||||||||||||||||||| | |||||||||||||||
Sbjct: 1477 gcccactcgaagttgtccagcagcgaccacgcaaagta 1440
Score = 42.1 bits (21), Expect = 0.20
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 898 accatccaagttgaaagtcaa 918
|||||||||||||||||||||
Sbjct: 954 accatccaagttgaaagtcaa 934
>ref|NM_123047.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT5G36890 transcript variant AT5G36890.1 mRNA, complete
cds
Length = 1473
Score = 60.0 bits (30), Expect = 9e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 381 gcccactcgaagttgtccaggaacgaccacgcaaagta 418
|||||||||||||||||||| | |||||||||||||||
Sbjct: 1337 gcccactcgaagttgtccagcagcgaccacgcaaagta 1300
Score = 42.1 bits (21), Expect = 0.20
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 898 accatccaagttgaaagtcaa 918
|||||||||||||||||||||
Sbjct: 814 accatccaagttgaaagtcaa 794
>ref|NM_001036898.1| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT5G36890 transcript variant AT5G36890.2 mRNA, complete
cds
Length = 1780
Score = 60.0 bits (30), Expect = 9e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 381 gcccactcgaagttgtccaggaacgaccacgcaaagta 418
|||||||||||||||||||| | |||||||||||||||
Sbjct: 1476 gcccactcgaagttgtccagcagcgaccacgcaaagta 1439
Score = 42.1 bits (21), Expect = 0.20
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 898 accatccaagttgaaagtcaa 918
|||||||||||||||||||||
Sbjct: 953 accatccaagttgaaagtcaa 933
>ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complete sequence
Length = 26992728
Score = 60.0 bits (30), Expect = 9e-007
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 381 gcccactcgaagttgtccaggaacgaccacgcaaagta 418
|||||||||||||||||||| | |||||||||||||||
Sbjct: 14559530 gcccactcgaagttgtccagcagcgaccacgcaaagta 14559567
Score = 44.1 bits (22), Expect = 0.052
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 897 taccatccaagttgaaagtcaa 918
||||||||||||||||||||||
Sbjct: 14561012 taccatccaagttgaaagtcaa 14561033
>gb|BP649344.1|BP649344 BP649344 RAFL19 Arabidopsis thaliana cDNA clone RAFL19-13-E11 3',
mRNA sequence
Length = 362
Score = 56.0 bits (28), Expect = 1e-005
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 383 ccactcgaagttgtccaggaacgaccacgcaaagta 418
|||||||||||||||||| | |||||||||||||||
Sbjct: 271 ccactcgaagttgtccagcagcgaccacgcaaagta 306
>gb|CL515693.1|CL515693 SAIL_903_F03.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_903_F03.v1, DNA sequence
Length = 907
Score = 54.0 bits (27), Expect = 5e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 381 gcccactcgaagttgtccaggaacgaccacgcaaagta 418
|||||||||||||||||||| | |||||||||| ||||
Sbjct: 712 gcccactcgaagttgtccagcagcgaccacgcanagta 749
>gb|B30352.1|B30352 F3C5TW IGF Arabidopsis thaliana genomic clone F3C5, DNA sequence
Length = 608
Score = 42.1 bits (21), Expect = 0.20
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 369 gtgtagcccattgcccactcgaagttgtccaggaacgacca 409
||||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 372 gtgtatcccattgcccattcgaaattgtctagcaacgacca 332
>emb|CT026173.1| Arabidopsis thaliana T-DNA flanking sequence GK-198H08-025964,
genomic survey sequence
Length = 327
Score = 42.1 bits (21), Expect = 0.20
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 369 gtgtagcccattgcccactcgaagttgtccaggaacgacca 409
||||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 89 gtgtatcccattgcccattcgaaattgtctagcaacgacca 129
>emb|CT026174.1| Arabidopsis thaliana T-DNA flanking sequence GK-198H08-025984,
genomic survey sequence
Length = 348
Score = 42.1 bits (21), Expect = 0.20
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 369 gtgtagcccattgcccactcgaagttgtccaggaacgacca 409
||||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 89 gtgtatcccattgcccattcgaaattgtctagcaacgacca 129
>emb|AX506308.1| Sequence 1003 from Patent WO0216655
Length = 1521
Score = 42.1 bits (21), Expect = 0.20
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 369 gtgtagcccattgcccactcgaagttgtccaggaacgacca 409
||||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 1412 gtgtatcccattgcccattcgaaattgtctagcaacgacca 1372
>gb|AC004521.3| Arabidopsis thaliana chromosome 2 clone F4I1 map m336, complete
sequence
Length = 118327
Score = 42.1 bits (21), Expect = 0.20
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 369 gtgtagcccattgcccactcgaagttgtccaggaacgacca 409
||||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 69040 gtgtatcccattgcccattcgaaattgtctagcaacgacca 69000
>emb|BX821615.1|CNS0A8A3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL58ZE08 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 769
Score = 42.1 bits (21), Expect = 0.20
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 369 gtgtagcccattgcccactcgaagttgtccaggaacgacca 409
||||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 555 gtgtatcccattgcccattcgaaattgtctagcaacgacca 515
>emb|BX818939.1|CNS0A8X4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB29ZE02 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 1514
Score = 42.1 bits (21), Expect = 0.20
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 369 gtgtagcccattgcccactcgaagttgtccaggaacgacca 409
||||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 1407 gtgtatcccattgcccattcgaaattgtctagcaacgacca 1367
>ref|NM_130008.1| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
AT2G44450 mRNA, complete cds
Length = 1521
Score = 42.1 bits (21), Expect = 0.20
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 369 gtgtagcccattgcccactcgaagttgtccaggaacgacca 409
||||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 1412 gtgtatcccattgcccattcgaaattgtctagcaacgacca 1372
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 42.1 bits (21), Expect = 0.20
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 369 gtgtagcccattgcccactcgaagttgtccaggaacgacca 409
||||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 18350711 gtgtatcccattgcccattcgaaattgtctagcaacgacca 18350671
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 595,350
Number of Sequences: 1013581
Number of extensions: 595350
Number of successful extensions: 46525
Number of sequences better than 0.5: 19
Number of HSP's better than 0.5 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45905
Number of HSP's gapped (non-prelim): 620
length of query: 1118
length of database: 908,940,872
effective HSP length: 20
effective length of query: 1098
effective length of database: 888,669,252
effective search space: 975758838696
effective search space used: 975758838696
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)