BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1738980.2.1
(917 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE844891.1|BE844891 AD04A10T7 AD A. thaliana (Col-0 gl1)... 42 0.17
gb|BE844920.1|BE844920 AD04D11T7 AD A. thaliana (Col-0 gl1)... 42 0.17
gb|BE844922.1|BE844922 AD04E01T7 AD A. thaliana (Col-0 gl1)... 42 0.17
gb|BE844944.1|BE844944 AD04G04T7 AD A. thaliana (Col-0 gl1)... 42 0.17
gb|BE844956.1|BE844956 AD04H08T7 AD A. thaliana (Col-0 gl1)... 42 0.17
gb|BE844969.1|BE844969 AD05A12T7 AD A. thaliana (Col-0 gl1)... 42 0.17
gb|CD530156.1|CD530156 39N18 Arabidopsis Leaf Senescence Li... 42 0.17
gb|CK120899.1|CK120899 205h06.p1 AtM1 Arabidopsis thaliana ... 42 0.17
gb|BP796216.1|BP796216 BP796216 RAFL4 Arabidopsis thaliana ... 42 0.17
gb|AF288191.1|AF288191 Arabidopsis thaliana chromosome I gl... 42 0.17
gb|AF288192.1|AF288192 Arabidopsis thaliana chromosome I gl... 42 0.17
gb|AY091102.1| Arabidopsis thaliana At1g10370 mRNA sequence 42 0.17
emb|AX506970.1| Sequence 1665 from Patent WO0216655 42 0.17
emb|BX814035.1|CNS0ADFO Arabidopsis thaliana Full-length cD... 42 0.17
dbj|AB039930.1| Arabidopsis thaliana ERD9 mRNA for glutathi... 42 0.17
gb|BT023743.1| Arabidopsis thaliana At1g10370 gene, complet... 42 0.17
ref|NM_100911.2| Arabidopsis thaliana ATGSTU17 (GLUTATHIONE... 42 0.17
>gb|BE844891.1|BE844891 AD04A10T7 AD A. thaliana (Col-0 gl1) subtracted library enriched
for salt-induced transcripts;10-14 day seedlings 4h
160mM NaCl stress Arabidopsis thaliana cDNA clone
AD04A10 similar to (AC005489) glutathione S-transferase
F14N23.26, mRNA sequence
Length = 520
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 346 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 394
>gb|BE844920.1|BE844920 AD04D11T7 AD A. thaliana (Col-0 gl1) subtracted library enriched
for salt-induced transcripts;10-14 day seedlings 4h
160mM NaCl stress Arabidopsis thaliana cDNA clone
AD04D11 similar to (AC005489) F14N23.26; glutathione
S-transferase, mRNA sequence
Length = 450
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 322 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 370
>gb|BE844922.1|BE844922 AD04E01T7 AD A. thaliana (Col-0 gl1) subtracted library enriched
for salt-induced transcripts;10-14 day seedlings 4h
160mM NaCl stress Arabidopsis thaliana cDNA clone
AD04E01 similar to (AC005489) F14N23.26; glutathione
S-transferase, mRNA sequence
Length = 522
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 322 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 370
>gb|BE844944.1|BE844944 AD04G04T7 AD A. thaliana (Col-0 gl1) subtracted library enriched
for salt-induced transcripts;10-14 day seedlings 4h
160mM NaCl stress Arabidopsis thaliana cDNA clone
AD04G04 similar to (AC005489) F14N23.26 glutathione
S-transferase, mRNA sequence
Length = 707
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 338 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 386
>gb|BE844956.1|BE844956 AD04H08T7 AD A. thaliana (Col-0 gl1) subtracted library enriched
for salt-induced transcripts;10-14 day seedlings 4h
160mM NaCl stress Arabidopsis thaliana cDNA clone
AD04H08 similar to (AC005489) glutathione S-transferase
3 F14N23.26, mRNA sequence
Length = 511
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 344 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 392
>gb|BE844969.1|BE844969 AD05A12T7 AD A. thaliana (Col-0 gl1) subtracted library enriched
for salt-induced transcripts;10-14 day seedlings 4h
160mM NaCl stress Arabidopsis thaliana cDNA clone
AD05A12 similar to glutathione transferase (EC
2.5.1.18), mRNA sequence
Length = 429
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 59 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 107
>gb|CD530156.1|CD530156 39N18 Arabidopsis Leaf Senescence Library Arabidopsis thaliana cDNA
3', mRNA sequence
Length = 420
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 52 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 100
>gb|CK120899.1|CK120899 205h06.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011H06205
5-PRIME, mRNA sequence
Length = 744
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 341 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 389
>gb|BP796216.1|BP796216 BP796216 RAFL4 Arabidopsis thaliana cDNA clone RAFL04-15-M03 5',
mRNA sequence
Length = 670
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 358 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 406
>gb|AF288191.1|AF288191 Arabidopsis thaliana chromosome I glutathione S-transferase (GST30)
mRNA, complete cds
Length = 684
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 274 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 322
>gb|AF288192.1|AF288192 Arabidopsis thaliana chromosome I glutathione S-transferase
(GST30b) mRNA, complete cds
Length = 624
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 274 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 322
>gb|AY091102.1| Arabidopsis thaliana At1g10370 mRNA sequence
Length = 962
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 360 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 408
>emb|AX506970.1| Sequence 1665 from Patent WO0216655
Length = 513
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 274 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 322
>emb|BX814035.1|CNS0ADFO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTFB53ZB12 of Flowers and buds of strain col-0 of
Arabidopsis thaliana (thale cress)
Length = 830
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 346 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 394
>dbj|AB039930.1| Arabidopsis thaliana ERD9 mRNA for glutathione S-transferase,
complete cds
Length = 964
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 343 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 391
>gb|BT023743.1| Arabidopsis thaliana At1g10370 gene, complete cds
Length = 684
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 274 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 322
>ref|NM_100911.2| Arabidopsis thaliana ATGSTU17 (GLUTATHIONE S-TRANSFERASE 30);
glutathione transferase AT1G10370 (ATGSTU17) mRNA,
complete cds
Length = 961
Score = 42.1 bits (21), Expect = 0.17
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 346 tacgaccgcgccatggctcgcttctgggcagcctacgtcgacgacaagt 394
||||| || ||||||||||| |||||||| || ||| ||||||| ||||
Sbjct: 359 tacgatcgggccatggctcggttctgggctgcttacatcgacgaaaagt 407
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 265,263
Number of Sequences: 1013581
Number of extensions: 265263
Number of successful extensions: 20442
Number of sequences better than 0.5: 17
Number of HSP's better than 0.5 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20425
Number of HSP's gapped (non-prelim): 17
length of query: 917
length of database: 908,940,872
effective HSP length: 20
effective length of query: 897
effective length of database: 888,669,252
effective search space: 797136319044
effective search space used: 797136319044
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)