BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.654
(682 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AA042635.1|AA042635 24867 CD4-13 Arabidopsis thaliana cD... 62 1e-007
gb|BE528163.1|BE528163 M70D01STM Arabidopsis developing see... 62 1e-007
gb|AU235381.1|AU235381 AU235381 RAFL14 Arabidopsis thaliana... 62 1e-007
gb|AY128405.1| Arabidopsis thaliana putative cytochrome b5 ... 62 1e-007
gb|BT000085.1| Arabidopsis thaliana putative cytochrome b5 ... 62 1e-007
emb|AX506505.1| Sequence 1200 from Patent WO0216655 62 1e-007
ref|NM_128831.2| Arabidopsis thaliana B5 #4 AT2G32720 (B5 #... 62 1e-007
emb|BX821782.1|CNS0A99H Arabidopsis thaliana Full-length cD... 56 8e-006
gb|BP802283.1|BP802283 BP802283 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|AC003974.3| Arabidopsis thaliana chromosome 2 clone F24L... 52 1e-004
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 52 1e-004
gb|B77520.1|B77520 T26I17TF TAMU Arabidopsis thaliana genom... 48 0.002
gb|CB074863.1|CB074863 EST03016 Arabidopsis Acute Ozone poo... 48 0.002
gb|AV536831.1|AV536831 AV536831 Arabidopsis thaliana liquid... 48 0.002
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 48 0.002
gb|AY084761.1| Arabidopsis thaliana clone 11704 mRNA, compl... 48 0.002
gb|AF332415.1| Arabidopsis thaliana clone C00075 (e) putati... 48 0.002
gb|AC013427.3|T1K7 Sequence of BAC T1K7 from Arabidopsis th... 48 0.002
gb|AC079829.6|AC079829 Arabidopsis thaliana chromosome 1 BA... 48 0.002
emb|BX818061.1|CNS0AB8Z Arabidopsis thaliana Full-length cD... 48 0.002
dbj|AK117459.1| Arabidopsis thaliana At1g26340 mRNA for put... 48 0.002
ref|NM_102398.1| Arabidopsis thaliana B5 #6 AT1G26340 (B5 #... 48 0.002
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 48 0.002
gb|AA042329.1|AA042329 24666 CD4-13 Arabidopsis thaliana cD... 44 0.031
gb|H37504.1|H37504 15633 Lambda-PRL2 Arabidopsis thaliana c... 44 0.031
gb|N97190.1|N97190 22369 Lambda-PRL2 Arabidopsis thaliana c... 44 0.031
gb|AI994177.1|AI994177 701500026 A. thaliana, Ohio State cl... 44 0.031
gb|BE038203.1|BE038203 AA10C09 AA Arabidopsis thaliana cDNA... 44 0.031
gb|AV782086.1|AV782086 AV782086 RAFL4 Arabidopsis thaliana ... 44 0.031
gb|AV821583.1|AV821583 AV821583 RAFL4 Arabidopsis thaliana ... 44 0.031
gb|CB261338.1|CB261338 07-E9573-012-004-N02-T7R MPIZ-ADIS-0... 44 0.031
gb|CB264717.1|CB264717 44-E015024-035-004-H12-T7R MPIZ-ADIS... 44 0.031
gb|AV533433.1|AV533433 AV533433 Arabidopsis thaliana flower... 44 0.031
gb|AV533557.1|AV533557 AV533557 Arabidopsis thaliana flower... 44 0.031
gb|AV553489.1|AV553489 AV553489 Arabidopsis thaliana roots ... 44 0.031
gb|BP812343.1|BP812343 BP812343 RAFL19 Arabidopsis thaliana... 44 0.031
gb|BP832754.1|BP832754 BP832754 RAFL19 Arabidopsis thaliana... 44 0.031
gb|BP862245.1|BP862245 BP862245 RAFL21 Arabidopsis thaliana... 44 0.031
gb|AC024228.1|AC024228 Arabidopsis thaliana chromosome I cl... 44 0.031
gb|AF370256.1| Arabidopsis thaliana putative cytochrome b5 ... 44 0.031
gb|AY063073.1| Arabidopsis thaliana putative cytochrome b5 ... 44 0.031
gb|AY086738.1| Arabidopsis thaliana clone 27167 mRNA, compl... 44 0.031
gb|AC073942.2|F16L1 Sequence of BAC F16L1 from Arabidopsis ... 44 0.031
emb|BX841663.1|CNS09YKX Arabidopsis thaliana Full-length cD... 44 0.031
dbj|AB007802.1| Arabidopsis thaliana mRNA for cytochrome b5... 44 0.031
gb|AY735521.1| Arabidopsis thaliana hypothetical protein AT... 44 0.031
gb|AY773817.1| Arabidopsis thaliana clone pENTR221-At1g2223... 44 0.031
ref|NM_102073.1| Arabidopsis thaliana unknown protein AT1G2... 44 0.031
ref|NM_124258.2| Arabidopsis thaliana ATB5-B AT5G48810 (ATB... 44 0.031
emb|AL950473.1| Arabidopsis thaliana T-DNA flanking sequenc... 42 0.12
gb|H76469.1|H76469 18174 Lambda-PRL2 Arabidopsis thaliana c... 42 0.12
gb|AV785501.1|AV785501 AV785501 RAFL6 Arabidopsis thaliana ... 42 0.12
gb|CB185798.1|CB185798 EST00725 Arabidopsis avirulent Pseud... 42 0.12
gb|CD534506.1|CD534506 39K14 Arabidopsis Leaf Senescence Li... 42 0.12
gb|AV532919.1|AV532919 AV532919 Arabidopsis thaliana flower... 42 0.12
gb|AV556249.1|AV556249 AV556249 Arabidopsis thaliana green ... 42 0.12
gb|BP593695.1|BP593695 BP593695 RAFL15 Arabidopsis thaliana... 42 0.12
gb|BP620349.1|BP620349 BP620349 RAFL16 Arabidopsis thaliana... 42 0.12
gb|BP644741.1|BP644741 BP644741 RAFL19 Arabidopsis thaliana... 42 0.12
gb|BP650322.1|BP650322 BP650322 RAFL19 Arabidopsis thaliana... 42 0.12
emb|BX829982.1|CNS0A1B1 Arabidopsis thaliana Full-length cD... 42 0.12
dbj|AB012242.1| Arabidopsis thaliana genomic DNA, chromosom... 42 0.12
dbj|BA000015.5| Arabidopsis thaliana DNA, chromosome 5, com... 42 0.12
ref|NC_003076.4| Arabidopsis thaliana chromosome 5, complet... 42 0.12
gb|B20752.1|B20752 T19M2-T7 TAMU Arabidopsis thaliana genom... 40 0.49
gb|B60831.1|B60831 T19M2TF TAMU Arabidopsis thaliana genomi... 40 0.49
emb|BX662728.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.49
emb|BX662824.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.49
emb|BX663278.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.49
emb|BX948813.1| Arabidopsis thaliana T-DNA flanking sequenc... 40 0.49
gb|Z30088.1|Z30088 ATTS1579 AC16H Arabidopsis thaliana cDNA... 40 0.49
gb|AA041093.1|AA041093 24359 CD4-13 Arabidopsis thaliana cD... 40 0.49
gb|AA395569.1|AA395569 27366 Lambda-PRL2 Arabidopsis thalia... 40 0.49
gb|AA395573.1|AA395573 27370 Lambda-PRL2 Arabidopsis thalia... 40 0.49
gb|AA597431.1|AA597431 29702 Lambda-PRL2 Arabidopsis thalia... 40 0.49
gb|AA041150.1|AA041150 24416 CD4-13 Arabidopsis thaliana cD... 40 0.49
gb|AA042294.1|AA042294 24631 CD4-13 Arabidopsis thaliana cD... 40 0.49
gb|N37915.1|N37915 19142 Lambda-PRL2 Arabidopsis thaliana c... 40 0.49
gb|T46728.1|T46728 9991 Lambda-PRL2 Arabidopsis thaliana cD... 40 0.49
gb|AI998053.1|AI998053 701672845 A. thaliana, Columbia Col-... 40 0.49
gb|BE038367.1|BE038367 AA12E12 AA Arabidopsis thaliana cDNA... 40 0.49
gb|BE662730.1|BE662730 EST00251 Arabidopsis Acute Ozone Rev... 40 0.49
gb|BE662731.1|BE662731 EST00252 Arabidopsis Acute Ozone Rev... 40 0.49
gb|BE662737.1|BE662737 EST00258 Arabidopsis Acute Ozone Rev... 40 0.49
gb|BE662936.1|BE662936 EST00086 Arabidopsis Acute Ozone For... 40 0.49
gb|AV784440.1|AV784440 AV784440 RAFL5 Arabidopsis thaliana ... 40 0.49
gb|AV788199.1|AV788199 AV788199 RAFL6 Arabidopsis thaliana ... 40 0.49
gb|AV790187.1|AV790187 AV790187 RAFL6 Arabidopsis thaliana ... 40 0.49
gb|AV790253.1|AV790253 AV790253 RAFL6 Arabidopsis thaliana ... 40 0.49
gb|AV810388.1|AV810388 AV810388 RAFL9 Arabidopsis thaliana ... 40 0.49
gb|AV819260.1|AV819260 AV819260 RAFL11 Arabidopsis thaliana... 40 0.49
gb|AV823470.1|AV823470 AV823470 RAFL5 Arabidopsis thaliana ... 40 0.49
gb|AV829138.1|AV829138 AV829138 RAFL9 Arabidopsis thaliana ... 40 0.49
gb|BU635978.1|BU635978 043F09 Infected Arabidopsis Leaf Ara... 40 0.49
gb|CB185880.1|CB185880 EST01071 Arabidopsis virulent Pseudo... 40 0.49
gb|CB239324.1|CB239324 EST01145 Arabidopsis virulent Pseudo... 40 0.49
gb|CB074186.1|CB074186 EST02508 Early Ovule Development For... 40 0.49
gb|CB074223.1|CB074223 EST01000 Virulent Peronospora parasi... 40 0.49
gb|CB074227.1|CB074227 EST01003 Virulent Peronospora parasi... 40 0.49
gb|CB074279.1|CB074279 EST00792 Virulent Peronospora parasi... 40 0.49
gb|CB074411.1|CB074411 EST00927 Virulent Peronospora parasi... 40 0.49
gb|CB074582.1|CB074582 EST0088 Virulent Peronospora parasit... 40 0.49
gb|CB074854.1|CB074854 EST03007 Arabidopsis Acute Ozone poo... 40 0.49
gb|CB074862.1|CB074862 EST03015 Arabidopsis Acute Ozone poo... 40 0.49
gb|CB097368.1|CB097368 EST00995 Virulent Peronospora parasi... 40 0.49
gb|CB165160.1|CB165160 EST00996 Virulent Peronospora parasi... 40 0.49
gb|CB260674.1|CB260674 77-E9409-012-002-J22-t7r MPIZ-ADIS-0... 40 0.49
gb|CB264047.1|CB264047 93-E014996-035-003-J24-T7R MPIZ-ADIS... 40 0.49
gb|CB264472.1|CB264472 59-E014993-035-003-E15-T7R MPIZ-ADIS... 40 0.49
gb|CB264569.1|CB264569 50-E015024-035-004-D14-T7R MPIZ-ADIS... 40 0.49
gb|CD532519.1|CD532519 27L22 Arabidopsis Leaf Senescence Li... 40 0.49
gb|AV440816.1|AV440816 AV440816 Arabidopsis thaliana above-... 40 0.49
gb|AV442487.1|AV442487 AV442487 Arabidopsis thaliana above-... 40 0.49
gb|AV522073.1|AV522073 AV522073 Arabidopsis thaliana aboveg... 40 0.49
gb|CF772955.1|CF772955 AG_FSL_10D03 Arabidopsis ag-1 35S:AG... 40 0.49
gb|CK117828.1|CK117828 209o05.p1 AtM1 Arabidopsis thaliana ... 40 0.49
gb|CK120495.1|CK120495 218i03.p1 AtM1 Arabidopsis thaliana ... 40 0.49
gb|CK120859.1|CK120859 205m15.p1 AtM1 Arabidopsis thaliana ... 40 0.49
gb|BP583959.1|BP583959 BP583959 RAFL14 Arabidopsis thaliana... 40 0.49
gb|BP585775.1|BP585775 BP585775 RAFL15 Arabidopsis thaliana... 40 0.49
gb|BP590615.1|BP590615 BP590615 RAFL15 Arabidopsis thaliana... 40 0.49
gb|BP590807.1|BP590807 BP590807 RAFL15 Arabidopsis thaliana... 40 0.49
gb|BP604146.1|BP604146 BP604146 RAFL16 Arabidopsis thaliana... 40 0.49
gb|BP605744.1|BP605744 BP605744 RAFL16 Arabidopsis thaliana... 40 0.49
gb|BP613728.1|BP613728 BP613728 RAFL16 Arabidopsis thaliana... 40 0.49
gb|BP618058.1|BP618058 BP618058 RAFL16 Arabidopsis thaliana... 40 0.49
gb|BP625892.1|BP625892 BP625892 RAFL17 Arabidopsis thaliana... 40 0.49
gb|BP635207.1|BP635207 BP635207 RAFL17 Arabidopsis thaliana... 40 0.49
gb|BP640153.1|BP640153 BP640153 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP645913.1|BP645913 BP645913 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP647114.1|BP647114 BP647114 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP650330.1|BP650330 BP650330 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP654385.1|BP654385 BP654385 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP656163.1|BP656163 BP656163 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP659500.1|BP659500 BP659500 RAFL19 Arabidopsis thaliana... 40 0.49
gb|CB252092.1|CB252092 35-E015331-019-005-E10-T7R MPIZ-ADIS... 40 0.49
gb|BP785536.1|BP785536 BP785536 RAFL7 Arabidopsis thaliana ... 40 0.49
gb|BP789578.1|BP789578 BP789578 RAFL7 Arabidopsis thaliana ... 40 0.49
gb|BP817499.1|BP817499 BP817499 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP825321.1|BP825321 BP825321 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP829835.1|BP829835 BP829835 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP838569.1|BP838569 BP838569 RAFL19 Arabidopsis thaliana... 40 0.49
gb|BP841997.1|BP841997 BP841997 RAFL21 Arabidopsis thaliana... 40 0.49
gb|BP850337.1|BP850337 BP850337 RAFL21 Arabidopsis thaliana... 40 0.49
gb|U60981.1|ATU60981 Arabidopsis thaliana Skp1p homolog mRN... 40 0.49
gb|U70034.1|ATU70034 Arabidopsis thaliana homologue to SKP1... 40 0.49
gb|AF013294.1|TM018A10 Arabidopsis thaliana BAC TM018A10 40 0.49
gb|AF089710.1|AF089710 Arabidopsis thaliana disease resista... 40 0.49
gb|AF059294.1|AF059294 Arabidopsis thaliana Skp1 homolog (S... 40 0.49
gb|U97020.1|ATU97020 Arabidopsis thaliana UFO binding prote... 40 0.49
emb|AX412253.1| Sequence 17 from Patent WO0222675 40 0.49
emb|AX412866.1| Sequence 630 from Patent WO0222675 40 0.49
gb|AY065223.1| Arabidopsis thaliana unknown protein (At4g00... 40 0.49
gb|AY080884.1| Arabidopsis thaliana putative SKP1/ASK1 prot... 40 0.49
gb|AY091053.1| Arabidopsis thaliana unknown protein (At5g25... 40 0.49
gb|AY113971.1| Arabidopsis thaliana putative SKP1/ASK1 prot... 40 0.49
gb|AY133786.1| Arabidopsis thaliana clone U19101 unknown pr... 40 0.49
gb|AY142586.1| Arabidopsis thaliana unknown protein (At4g00... 40 0.49
emb|AX506592.1| Sequence 1287 from Patent WO0216655 40 0.49
emb|AX507774.1| Sequence 2469 from Patent WO0216655 40 0.49
gb|AY086009.1| Arabidopsis thaliana clone 20618 mRNA, compl... 40 0.49
gb|BT010413.1| Arabidopsis thaliana At2g17740 mRNA, complet... 40 0.49
gb|AC006601.1|AC006601 Arabidopsis thaliana chromosome V ma... 40 0.49
gb|AC007396.6|AC007396 Genomic sequence for Arabidopsis tha... 40 0.49
emb|BX827460.1|CNS0A2HV Arabidopsis thaliana Full-length cD... 40 0.49
emb|BX814497.1|CNS0ACA2 Arabidopsis thaliana Full-length cD... 40 0.49
emb|BX814051.1|CNS0AEAP Arabidopsis thaliana Full-length cD... 40 0.49
emb|BX814213.1|CNS0AEBI Arabidopsis thaliana Full-length cD... 40 0.49
emb|BX814298.1|CNS0AEA8 Arabidopsis thaliana Full-length cD... 40 0.49
emb|BX814344.1|CNS0AEA0 Arabidopsis thaliana Full-length cD... 40 0.49
emb|AJ270058.1| Arabidopsis thaliana DNA chromosome 4, shor... 40 0.49
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 40 0.49
emb|CR379321.1| Arabidopsis thaliana transposon insertion S... 40 0.49
emb|CR384207.1| Arabidopsis thaliana transposon insertion S... 40 0.49
dbj|AK175184.1| Arabidopsis thaliana mRNA, complete cds, cl... 40 0.49
dbj|AK175399.1| Arabidopsis thaliana mRNA, complete cds, cl... 40 0.49
dbj|AK176583.1| Arabidopsis thaliana mRNA, complete cds, cl... 40 0.49
dbj|AK176759.1| Arabidopsis thaliana mRNA, complete cds, cl... 40 0.49
emb|AL161512.2|ATCHRIV24 Arabidopsis thaliana DNA chromosom... 40 0.49
emb|AL161491.2|ATCHRIV3 Arabidopsis thaliana DNA chromosome... 40 0.49
emb|AL161813.1|ATT32A17 Arabidopsis thaliana DNA chromosome... 40 0.49
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 40 0.49
ref|NM_127328.1| Arabidopsis thaliana unknown protein AT2G1... 40 0.49
ref|NM_116941.1| Arabidopsis thaliana unknown protein AT4G0... 40 0.49
ref|NM_122470.2| Arabidopsis thaliana unknown protein AT5G2... 40 0.49
ref|NM_106245.3| Arabidopsis thaliana SKP1 (ARABIDOPSIS SKP... 40 0.49
ref|NM_116322.4| Arabidopsis thaliana transcription factor ... 40 0.49
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 40 0.49
emb|CS226657.1| Sequence 440 from Patent WO2005098015 40 0.49
>gb|AA042635.1|AA042635 24867 CD4-13 Arabidopsis thaliana cDNA clone E12A9T7, mRNA sequence
Length = 613
Score = 61.9 bits (31), Expect = 1e-007
Identities = 91/111 (81%)
Strand = Plus / Minus
Query: 442 gctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggac 501
|||||| ||||| || || |||||||| || |||||||| | || ||||||| || ||
Sbjct: 194 gctgtgacccacgtcctcaaaatcatccgttgcatccttacctgttgaagacaagagaac 135
Query: 502 atcatcacctccagggtggtcctccagaaacttggtcacattgtacacctt 552
||| || || || || ||||| || ||||||||||||||||||||||||||
Sbjct: 134 atcgtccccacctggatggtcttcaagaaacttggtcacattgtacacctt 84
>gb|BE528163.1|BE528163 M70D01STM Arabidopsis developing seed Arabidopsis thaliana cDNA
clone 600037202R1 5', mRNA sequence
Length = 279
Score = 61.9 bits (31), Expect = 1e-007
Identities = 91/111 (81%)
Strand = Plus / Minus
Query: 442 gctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggac 501
|||||| ||||| || || |||||||| || |||||||| | || ||||||| || ||
Sbjct: 237 gctgtgacccacgtcctcaaaatcatccgttgcatccttacctgttgaagacaagagaac 178
Query: 502 atcatcacctccagggtggtcctccagaaacttggtcacattgtacacctt 552
||| || || || || ||||| || ||||||||||||||||||||||||||
Sbjct: 177 atcgtccccacctggatggtcttcaagaaacttggtcacattgtacacctt 127
>gb|AU235381.1|AU235381 AU235381 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-07-C08 5',
mRNA sequence
Length = 645
Score = 61.9 bits (31), Expect = 1e-007
Identities = 91/111 (81%)
Strand = Plus / Minus
Query: 442 gctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggac 501
|||||| ||||| || || |||||||| || |||||||| | || ||||||| || ||
Sbjct: 224 gctgtgacccacgtcctcaaaatcatccgttgcatccttacctgttgaagacaagagaac 165
Query: 502 atcatcacctccagggtggtcctccagaaacttggtcacattgtacacctt 552
||| || || || || ||||| || ||||||||||||||||||||||||||
Sbjct: 164 atcgtccccacctggatggtcttcaagaaacttggtcacattgtacacctt 114
>gb|AY128405.1| Arabidopsis thaliana putative cytochrome b5 (At2g32720) mRNA,
complete cds
Length = 588
Score = 61.9 bits (31), Expect = 1e-007
Identities = 91/111 (81%)
Strand = Plus / Minus
Query: 442 gctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggac 501
|||||| ||||| || || |||||||| || |||||||| | || ||||||| || ||
Sbjct: 229 gctgtgacccacgtcctcaaaatcatccgttgcatccttacctgttgaagacaagagaac 170
Query: 502 atcatcacctccagggtggtcctccagaaacttggtcacattgtacacctt 552
||| || || || || ||||| || ||||||||||||||||||||||||||
Sbjct: 169 atcgtccccacctggatggtcttcaagaaacttggtcacattgtacacctt 119
>gb|BT000085.1| Arabidopsis thaliana putative cytochrome b5 (At2g32720) mRNA,
complete cds
Length = 532
Score = 61.9 bits (31), Expect = 1e-007
Identities = 91/111 (81%)
Strand = Plus / Minus
Query: 442 gctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggac 501
|||||| ||||| || || |||||||| || |||||||| | || ||||||| || ||
Sbjct: 195 gctgtgacccacgtcctcaaaatcatccgttgcatccttacctgttgaagacaagagaac 136
Query: 502 atcatcacctccagggtggtcctccagaaacttggtcacattgtacacctt 552
||| || || || || ||||| || ||||||||||||||||||||||||||
Sbjct: 135 atcgtccccacctggatggtcttcaagaaacttggtcacattgtacacctt 85
>emb|AX506505.1| Sequence 1200 from Patent WO0216655
Length = 405
Score = 61.9 bits (31), Expect = 1e-007
Identities = 91/111 (81%)
Strand = Plus / Minus
Query: 442 gctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggac 501
|||||| ||||| || || |||||||| || |||||||| | || ||||||| || ||
Sbjct: 195 gctgtgacccacgtcctcaaaatcatccgttgcatccttacctgttgaagacaagagaac 136
Query: 502 atcatcacctccagggtggtcctccagaaacttggtcacattgtacacctt 552
||| || || || || ||||| || ||||||||||||||||||||||||||
Sbjct: 135 atcgtccccacctggatggtcttcaagaaacttggtcacattgtacacctt 85
>ref|NM_128831.2| Arabidopsis thaliana B5 #4 AT2G32720 (B5 #4) mRNA, complete cds
Length = 650
Score = 61.9 bits (31), Expect = 1e-007
Identities = 91/111 (81%)
Strand = Plus / Minus
Query: 442 gctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggac 501
|||||| ||||| || || |||||||| || |||||||| | || ||||||| || ||
Sbjct: 237 gctgtgacccacgtcctcaaaatcatccgttgcatccttacctgttgaagacaagagaac 178
Query: 502 atcatcacctccagggtggtcctccagaaacttggtcacattgtacacctt 552
||| || || || || ||||| || ||||||||||||||||||||||||||
Sbjct: 177 atcgtccccacctggatggtcttcaagaaacttggtcacattgtacacctt 127
>emb|BX821782.1|CNS0A99H Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL73ZD01 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 595
Score = 56.0 bits (28), Expect = 8e-006
Identities = 76/92 (82%)
Strand = Plus / Minus
Query: 461 aaatcatcggtagcatccttggcagtggaagacagcaggacatcatcacctccagggtgg 520
|||||||| || |||||||| | || ||||||| || ||||| || || || || |||
Sbjct: 149 aaatcatccgttgcatccttacctgttgaagacaagagaacatcgtccccacctggatgg 90
Query: 521 tcctccagaaacttggtcacattgtacacctt 552
|| || ||||||||||||||||||||||||||
Sbjct: 89 tcttcaagaaacttggtcacattgtacacctt 58
>gb|BP802283.1|BP802283 BP802283 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-23-L07 5',
mRNA sequence
Length = 365
Score = 54.0 bits (27), Expect = 3e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 518 tggtcctccagaaacttggtcacattgtacacctt 552
||||| || ||||||||||||||||||||||||||
Sbjct: 191 tggtcttcaagaaacttggtcacattgtacacctt 157
>gb|AC003974.3| Arabidopsis thaliana chromosome 2 clone F24L7 map TEn5, complete
sequence
Length = 92612
Score = 52.0 bits (26), Expect = 1e-004
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 518 tggtcctccagaaacttggtcacattgtacacct 551
||||| || |||||||||||||||||||||||||
Sbjct: 61780 tggtcttcaagaaacttggtcacattgtacacct 61747
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 52.0 bits (26), Expect = 1e-004
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 518 tggtcctccagaaacttggtcacattgtacacct 551
||||| || |||||||||||||||||||||||||
Sbjct: 13884458 tggtcttcaagaaacttggtcacattgtacacct 13884491
Score = 40.1 bits (20), Expect = 0.49
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 633 tcctcctcttcctcttcctc 652
||||||||||||||||||||
Sbjct: 7714341 tcctcctcttcctcttcctc 7714360
>gb|B77520.1|B77520 T26I17TF TAMU Arabidopsis thaliana genomic clone T26I17, DNA
sequence
Length = 413
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 548 accttgccgccgatgacgagccagcagtcatc 579
||||||||| ||||||||| ||||||||||||
Sbjct: 68 accttgccgtcgatgacgacccagcagtcatc 37
>gb|CB074863.1|CB074863 EST03016 Arabidopsis Acute Ozone pooled time-points
Forward-Subtracted Library Arabidopsis thaliana cDNA
clone AtAOzLH10 similar to putative protein, mRNA
sequence
Length = 305
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 659 ccgcgtacctgcccgggcggccgc 682
||||||||||||||||||||||||
Sbjct: 274 ccgcgtacctgcccgggcggccgc 297
>gb|AV536831.1|AV536831 AV536831 Arabidopsis thaliana liquid-cultured seedlings Columbia
Arabidopsis thaliana cDNA clone pAZNII0594R 5', mRNA
sequence
Length = 429
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 548 accttgccgccgatgacgagccagcagtcatc 579
||||||||| ||||||||| ||||||||||||
Sbjct: 159 accttgccgtcgatgacgacccagcagtcatc 128
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 548 accttgccgccgatgacgagccagcagtcatc 579
||||||||| ||||||||| ||||||||||||
Sbjct: 9122687 accttgccgtcgatgacgacccagcagtcatc 9122656
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 631 catcctcctcttcctcttcctc 652
||||||||||||||||||||||
Sbjct: 7850405 catcctcctcttcctcttcctc 7850384
>gb|AY084761.1| Arabidopsis thaliana clone 11704 mRNA, complete sequence
Length = 716
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 548 accttgccgccgatgacgagccagcagtcatc 579
||||||||| ||||||||| ||||||||||||
Sbjct: 181 accttgccgtcgatgacgacccagcagtcatc 150
>gb|AF332415.1| Arabidopsis thaliana clone C00075 (e) putative cytochrome b5
protein (At1g26340) mRNA, complete cds
Length = 408
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 548 accttgccgccgatgacgagccagcagtcatc 579
||||||||| ||||||||| ||||||||||||
Sbjct: 89 accttgccgtcgatgacgacccagcagtcatc 58
>gb|AC013427.3|T1K7 Sequence of BAC T1K7 from Arabidopsis thaliana chromosome 1, complete
sequence
Length = 89473
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 548 accttgccgccgatgacgagccagcagtcatc 579
||||||||| ||||||||| ||||||||||||
Sbjct: 86363 accttgccgtcgatgacgacccagcagtcatc 86394
>gb|AC079829.6|AC079829 Arabidopsis thaliana chromosome 1 BAC F28B23 genomic sequence,
complete sequence
Length = 96699
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 548 accttgccgccgatgacgagccagcagtcatc 579
||||||||| ||||||||| ||||||||||||
Sbjct: 3652 accttgccgtcgatgacgacccagcagtcatc 3683
>emb|BX818061.1|CNS0AB8Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTSIL59ZE05 of Silique of strain col-0 of Arabidopsis
thaliana (thale cress)
Length = 705
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 548 accttgccgccgatgacgagccagcagtcatc 579
||||||||| ||||||||| ||||||||||||
Sbjct: 164 accttgccgtcgatgacgacccagcagtcatc 133
>dbj|AK117459.1| Arabidopsis thaliana At1g26340 mRNA for putative cytochrome b5,
complete cds, clone: RAFL17-06-H09
Length = 699
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 548 accttgccgccgatgacgagccagcagtcatc 579
||||||||| ||||||||| ||||||||||||
Sbjct: 175 accttgccgtcgatgacgacccagcagtcatc 144
>ref|NM_102398.1| Arabidopsis thaliana B5 #6 AT1G26340 (B5 #6) mRNA, complete cds
Length = 716
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 548 accttgccgccgatgacgagccagcagtcatc 579
||||||||| ||||||||| ||||||||||||
Sbjct: 181 accttgccgtcgatgacgacccagcagtcatc 150
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 548 accttgccgccgatgacgagccagcagtcatc 579
||||||||| ||||||||| ||||||||||||
Sbjct: 9114067 accttgccgtcgatgacgacccagcagtcatc 9114036
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 631 catcctcctcttcctcttcctc 652
||||||||||||||||||||||
Sbjct: 7850580 catcctcctcttcctcttcctc 7850559
Score = 40.1 bits (20), Expect = 0.49
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 637 cctcttcctcttcctctggt 656
||||||||||||||||||||
Sbjct: 28521083 cctcttcctcttcctctggt 28521064
>gb|AA042329.1|AA042329 24666 CD4-13 Arabidopsis thaliana cDNA clone E6E11T7, mRNA sequence
Length = 513
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 196 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 137
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 136 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 79
>gb|H37504.1|H37504 15633 Lambda-PRL2 Arabidopsis thaliana cDNA clone 182H10T7, mRNA
sequence
Length = 568
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 284 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 225
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 224 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 167
>gb|N97190.1|N97190 22369 Lambda-PRL2 Arabidopsis thaliana cDNA clone 246C18T7, mRNA
sequence
Length = 454
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 265 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 206
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 205 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 148
>gb|AI994177.1|AI994177 701500026 A. thaliana, Ohio State clone set Arabidopsis thaliana
cDNA clone 701500026, mRNA sequence
Length = 563
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 238 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 179
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 178 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 121
>gb|BE038203.1|BE038203 AA10C09 AA Arabidopsis thaliana cDNA 5' similar to cytochrome b5,
mRNA sequence
Length = 621
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 235 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 176
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 175 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 118
>gb|AV782086.1|AV782086 AV782086 RAFL4 Arabidopsis thaliana cDNA clone RAFL04-13-N15 3',
mRNA sequence
Length = 587
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Plus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 413 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 472
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 473 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 530
>gb|AV821583.1|AV821583 AV821583 RAFL4 Arabidopsis thaliana cDNA clone RAFL04-13-N15 5',
mRNA sequence
Length = 679
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 275 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 216
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 215 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 158
>gb|CB261338.1|CB261338 07-E9573-012-004-N02-T7R MPIZ-ADIS-012 Arabidopsis thaliana cDNA
clone MPIZp769N024Q 5-PRIME, mRNA sequence
Length = 586
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 202 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 143
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 142 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 85
>gb|CB264717.1|CB264717 44-E015024-035-004-H12-T7R MPIZ-ADIS-035 Arabidopsis thaliana cDNA
clone MPIZp2000H124Q 5-PRIME, mRNA sequence
Length = 631
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 249 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 190
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 189 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 132
>gb|AV533433.1|AV533433 AV533433 Arabidopsis thaliana flower buds Columbia Arabidopsis
thaliana cDNA clone FB061e03F 3', mRNA sequence
Length = 591
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Plus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 368 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 427
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 428 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 485
>gb|AV533557.1|AV533557 AV533557 Arabidopsis thaliana flower buds Columbia Arabidopsis
thaliana cDNA clone FB063g03F 3', mRNA sequence
Length = 488
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Plus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 350 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 409
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 410 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 467
>gb|AV553489.1|AV553489 AV553489 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ63g07R 5', mRNA sequence
Length = 531
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 243 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 184
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 183 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 126
>gb|BP812343.1|BP812343 BP812343 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-03-B21 5',
mRNA sequence
Length = 400
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 293 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 234
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 233 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 176
>gb|BP832754.1|BP832754 BP832754 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-93-K16 5',
mRNA sequence
Length = 396
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 293 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 234
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 233 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 176
>gb|BP862245.1|BP862245 BP862245 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-62-E24 5',
mRNA sequence
Length = 391
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 347 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 288
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 287 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 230
>gb|AC024228.1|AC024228 Arabidopsis thaliana chromosome I clone F8J5, *** SEQUENCING IN
PROGRESS ***, 7 unordered pieces
Length = 48282
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 631 catcctcctcttcctcttcctc 652
||||||||||||||||||||||
Sbjct: 25126 catcctcctcttcctcttcctc 25147
>gb|AF370256.1| Arabidopsis thaliana putative cytochrome b5 protein (At5g48810)
mRNA, complete cds
Length = 702
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 274 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 215
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 214 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 157
>gb|AY063073.1| Arabidopsis thaliana putative cytochrome b5 protein (At5g48810)
mRNA, complete cds
Length = 454
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 188 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 129
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 128 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 71
>gb|AY086738.1| Arabidopsis thaliana clone 27167 mRNA, complete sequence
Length = 706
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 294 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 235
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 234 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 177
>gb|AC073942.2|F16L1 Sequence of BAC F16L1 from Arabidopsis thaliana chromosome 1,
complete sequence
Length = 36030
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 631 catcctcctcttcctcttcctc 652
||||||||||||||||||||||
Sbjct: 9693 catcctcctcttcctcttcctc 9714
>emb|BX841663.1|CNS09YKX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
GSLTLS59ZH11 of Adult vegetative tissue of strain col-0
of Arabidopsis thaliana (thale cress)
Length = 620
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 255 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 196
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 195 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 138
>dbj|AB007802.1| Arabidopsis thaliana mRNA for cytochrome b5, complete cds
Length = 631
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 215 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 156
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 155 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 98
>gb|AY735521.1| Arabidopsis thaliana hypothetical protein AT1G22230 mRNA, complete
cds
Length = 1289
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 631 catcctcctcttcctcttcctc 652
||||||||||||||||||||||
Sbjct: 731 catcctcctcttcctcttcctc 710
>gb|AY773817.1| Arabidopsis thaliana clone pENTR221-At1g22230 hypothetical protein
(At1g22230) gene, complete cds
Length = 945
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 631 catcctcctcttcctcttcctc 652
||||||||||||||||||||||
Sbjct: 499 catcctcctcttcctcttcctc 478
>ref|NM_102073.1| Arabidopsis thaliana unknown protein AT1G22230 mRNA, complete cds
Length = 945
Score = 44.1 bits (22), Expect = 0.031
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 631 catcctcctcttcctcttcctc 652
||||||||||||||||||||||
Sbjct: 499 catcctcctcttcctcttcctc 478
>ref|NM_124258.2| Arabidopsis thaliana ATB5-B AT5G48810 (ATB5-B) mRNA, complete cds
Length = 1119
Score = 44.1 bits (22), Expect = 0.031
Identities = 94/118 (79%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcaggacatcatca 508
|||||||| |||||||||||||| ||||| || | || |||| || | || ||||||
Sbjct: 294 cccacatcctcgaaatcatcggtcgcatctttccctgtagaagtcaagataacctcatca 235
Query: 509 cctccagggtggtcctccagaaacttggtcacattgtacaccttgccgccgatgacga 566
|| ||||| || || |||| ||||| ||||||| || ||||||||| |||||||||
Sbjct: 234 ccaccaggatgatcatccaagaactttgtcacatcataaaccttgccgtcgatgacga 177
>emb|AL950473.1| Arabidopsis thaliana T-DNA flanking sequence GK-328H06-016034,
genomic survey sequence
Length = 188
Score = 42.1 bits (21), Expect = 0.12
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 449 cccacatcttcgaaatcatcggtagcatc 477
|||||||| |||||||||||||| |||||
Sbjct: 138 cccacatcctcgaaatcatcggtcgcatc 110
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 330,208
Number of Sequences: 1013581
Number of extensions: 330208
Number of successful extensions: 32109
Number of sequences better than 0.5: 190
Number of HSP's better than 0.5 without gapping: 195
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29840
Number of HSP's gapped (non-prelim): 2261
length of query: 682
length of database: 908,940,872
effective HSP length: 20
effective length of query: 662
effective length of database: 888,669,252
effective search space: 588299044824
effective search space used: 588299044824
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)