BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.623
(863 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CL506040.1|CL506040 SAIL_75_G05.v1 SAIL Collection Arabi... 52 2e-004
gb|U74119.1|U74119 ATU74119 NaCl-treated Arabidopsis subtra... 52 2e-004
gb|T23018.1|T23018 5026 Lambda-PRL2 Arabidopsis thaliana cD... 52 2e-004
gb|R90499.1|R90499 16854 Lambda-PRL2 Arabidopsis thaliana c... 52 2e-004
gb|N37770.1|N37770 18997 Lambda-PRL2 Arabidopsis thaliana c... 52 2e-004
gb|T20406.1|T20406 2414 Lambda-PRL2 Arabidopsis thaliana cD... 52 2e-004
gb|T13902.1|T13902 2067 Lambda-PRL2 Arabidopsis thaliana cD... 52 2e-004
gb|T21802.1|T21802 3810 Lambda-PRL2 Arabidopsis thaliana cD... 52 2e-004
gb|T43712.1|T43712 6975 Lambda-PRL2 Arabidopsis thaliana cD... 52 2e-004
gb|T45603.1|T45603 8866 Lambda-PRL2 Arabidopsis thaliana cD... 52 2e-004
gb|BE529654.1|BE529654 M75G22STM Arabidopsis developing see... 52 2e-004
gb|AV831525.1|AV831525 AV831525 RAFL9 Arabidopsis thaliana ... 52 2e-004
gb|AV831837.1|AV831837 AV831837 RAFL9 Arabidopsis thaliana ... 52 2e-004
gb|CB258522.1|CB258522 02-E011798-014-004-C02-T7R MPIZ-ADIS... 52 2e-004
gb|CB258524.1|CB258524 02-E011802-014-004-C02-T7R MPIZ-ADIS... 52 2e-004
gb|CB259466.1|CB259466 47-E9601-013-003-M12-t7r MPIZ-ADIS-0... 52 2e-004
gb|CF652237.1|CF652237 42-L020580-066-004-D12-SP6P MPIZ-ADI... 52 2e-004
gb|CF652408.1|CF652408 53-L020578-066-004-I14-SP6P MPIZ-ADI... 52 2e-004
gb|AV526150.1|AV526150 AV526150 Arabidopsis thaliana aboveg... 52 2e-004
gb|AV541453.1|AV541453 AV541453 Arabidopsis thaliana roots ... 52 2e-004
gb|AV550032.1|AV550032 AV550032 Arabidopsis thaliana roots ... 52 2e-004
gb|AV553032.1|AV553032 AV553032 Arabidopsis thaliana roots ... 52 2e-004
gb|AV562357.1|AV562357 AV562357 Arabidopsis thaliana green ... 52 2e-004
gb|CK119219.1|CK119219 213k18.p1 AtM1 Arabidopsis thaliana ... 52 2e-004
gb|CK119765.1|CK119765 201d05.p1 AtM1 Arabidopsis thaliana ... 52 2e-004
gb|CK119838.1|CK119838 210l05.p1 AtM1 Arabidopsis thaliana ... 52 2e-004
gb|CK119932.1|CK119932 210b03.p1 AtM1 Arabidopsis thaliana ... 52 2e-004
gb|CK120354.1|CK120354 207i18.p1 AtM1 Arabidopsis thaliana ... 52 2e-004
gb|CK121708.1|CK121708 201p12.p1 AtM1 Arabidopsis thaliana ... 52 2e-004
gb|BP633713.1|BP633713 BP633713 RAFL17 Arabidopsis thaliana... 52 2e-004
gb|BP560592.2|BP560592 BP560592 RAFL4 Arabidopsis thaliana ... 52 2e-004
gb|CB253115.1|CB253115 08-E018439-019-009-P01-T7R MPIZ-ADIS... 52 2e-004
gb|CB255490.1|CB255490 39-E015332-019-005-N09-T7R MPIZ-ADIS... 52 2e-004
gb|BP797009.1|BP797009 BP797009 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP801900.1|BP801900 BP801900 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP804157.1|BP804157 BP804157 RAFL14 Arabidopsis thaliana... 52 2e-004
gb|BP809323.1|BP809323 BP809323 RAFL16 Arabidopsis thaliana... 52 2e-004
gb|BP824682.1|BP824682 BP824682 RAFL19 Arabidopsis thaliana... 52 2e-004
gb|BP845040.1|BP845040 BP845040 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|BP847018.1|BP847018 BP847018 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|BP858986.1|BP858986 BP858986 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|BP861959.1|BP861959 BP861959 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|BP864711.1|BP864711 BP864711 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|BP866918.1|BP866918 BP866918 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|BP866933.1|BP866933 BP866933 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|BP868040.1|BP868040 BP868040 RAFL21 Arabidopsis thaliana... 52 2e-004
gb|L04171.1|ATHCCRB Arabidopsis thaliana Ccr1 mRNA, complet... 52 2e-004
gb|L00649.1|ATHRBPB Arabidopsis thaliana RNA-binding protei... 52 2e-004
emb|AX412730.1| Sequence 494 from Patent WO0222675 52 2e-004
gb|AY034997.1| Arabidopsis thaliana putative glycine-rich p... 52 2e-004
emb|BX829240.1|CNS0A3IA Arabidopsis thaliana Full-length cD... 52 2e-004
emb|AJ270060.1| Arabidopsis thaliana DNA chromosome 4, long... 52 2e-004
emb|CQ803620.1| Sequence 31 from Patent WO2004035798 52 2e-004
emb|AL050351.1|ATT22F8 Arabidopsis thaliana DNA chromosome ... 52 2e-004
emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosom... 52 2e-004
emb|Z14988.1|ATGRP8 A.thaliana mRNA for glycine rich protein 52 2e-004
ref|NM_120087.2| Arabidopsis thaliana ATGRP8 (GLYCINE-RICH ... 52 2e-004
ref|NM_179192.1| Arabidopsis thaliana ATGRP8 (GLYCINE-RICH ... 52 2e-004
ref|NM_179193.1| Arabidopsis thaliana ATGRP8 (GLYCINE-RICH ... 52 2e-004
ref|NM_179194.1| Arabidopsis thaliana ATGRP8 (GLYCINE-RICH ... 52 2e-004
ref|NC_003075.3| Arabidopsis thaliana chromosome 4, complet... 52 2e-004
gb|AA597642.1|AA597642 29550 Lambda-PRL2 Arabidopsis thalia... 46 0.010
gb|AA598148.1|AA598148 29808 Lambda-PRL2 Arabidopsis thalia... 46 0.010
gb|R90503.1|R90503 16858 Lambda-PRL2 Arabidopsis thaliana c... 46 0.010
gb|N37807.1|N37807 19034 Lambda-PRL2 Arabidopsis thaliana c... 46 0.010
gb|T46354.1|T46354 9617 Lambda-PRL2 Arabidopsis thaliana cD... 46 0.010
gb|CB255489.1|CB255489 39-E015331-019-005-M10-T7R MPIZ-ADIS... 46 0.010
gb|BP837386.1|BP837386 BP837386 RAFL19 Arabidopsis thaliana... 46 0.010
gb|BP838988.1|BP838988 BP838988 RAFL19 Arabidopsis thaliana... 46 0.010
gb|AV555070.1|AV555070 AV555070 Arabidopsis thaliana green ... 44 0.040
gb|BP822586.1|BP822586 BP822586 RAFL19 Arabidopsis thaliana... 44 0.040
gb|BP828128.1|BP828128 BP828128 RAFL19 Arabidopsis thaliana... 44 0.040
gb|BP828581.1|BP828581 BP828581 RAFL19 Arabidopsis thaliana... 44 0.040
gb|BP836502.1|BP836502 BP836502 RAFL19 Arabidopsis thaliana... 44 0.040
gb|BP842760.1|BP842760 BP842760 RAFL21 Arabidopsis thaliana... 44 0.040
gb|BP847046.1|BP847046 BP847046 RAFL21 Arabidopsis thaliana... 44 0.040
gb|BP847974.1|BP847974 BP847974 RAFL21 Arabidopsis thaliana... 42 0.16
gb|BP858777.1|BP858777 BP858777 RAFL21 Arabidopsis thaliana... 42 0.16
>gb|CL506040.1|CL506040 SAIL_75_G05.v1 SAIL Collection Arabidopsis thaliana genomic clone
SAIL_75_G05.v1, DNA sequence
Length = 924
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 618 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 659
>gb|U74119.1|U74119 ATU74119 NaCl-treated Arabidopsis subtraction library Arabidopsis
thaliana cDNA clone OS047, mRNA sequence
Length = 450
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 55 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 96
>gb|T23018.1|T23018 5026 Lambda-PRL2 Arabidopsis thaliana cDNA clone 109C23T7, mRNA
sequence
Length = 376
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 55 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 96
>gb|R90499.1|R90499 16854 Lambda-PRL2 Arabidopsis thaliana cDNA clone 187P21T7, mRNA
sequence
Length = 433
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 55 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 96
>gb|N37770.1|N37770 18997 Lambda-PRL2 Arabidopsis thaliana cDNA clone 210D18T7, mRNA
sequence
Length = 408
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 56 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 97
>gb|T20406.1|T20406 2414 Lambda-PRL2 Arabidopsis thaliana cDNA clone 78H12T7, mRNA
sequence
Length = 353
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Minus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 297 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 256
>gb|T13902.1|T13902 2067 Lambda-PRL2 Arabidopsis thaliana cDNA clone 43C4T7, mRNA
sequence
Length = 395
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 55 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 96
>gb|T21802.1|T21802 3810 Lambda-PRL2 Arabidopsis thaliana cDNA clone 98G18T7, mRNA
sequence
Length = 463
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 22 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 63
>gb|T43712.1|T43712 6975 Lambda-PRL2 Arabidopsis thaliana cDNA clone 122K7T7, mRNA
sequence
Length = 412
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 27 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 68
>gb|T45603.1|T45603 8866 Lambda-PRL2 Arabidopsis thaliana cDNA clone 136O18T7, mRNA
sequence
Length = 412
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 37 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 78
>gb|BE529654.1|BE529654 M75G22STM Arabidopsis developing seed Arabidopsis thaliana cDNA
clone 600039084R1 5', mRNA sequence
Length = 243
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 32 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 73
>gb|AV831525.1|AV831525 AV831525 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-90-D19 5',
mRNA sequence
Length = 444
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 71 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 112
>gb|AV831837.1|AV831837 AV831837 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-96-F18 5',
mRNA sequence
Length = 474
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 67 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 108
>gb|CB258522.1|CB258522 02-E011798-014-004-C02-T7R MPIZ-ADIS-014 Arabidopsis thaliana cDNA
clone MPIZp771C024Q 5-PRIME, mRNA sequence
Length = 478
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 8 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 49
>gb|CB258524.1|CB258524 02-E011802-014-004-C02-T7R MPIZ-ADIS-014 Arabidopsis thaliana cDNA
clone MPIZp771C024Q 5-PRIME, mRNA sequence
Length = 475
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 8 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 49
>gb|CB259466.1|CB259466 47-E9601-013-003-M12-t7r MPIZ-ADIS-013 Arabidopsis thaliana cDNA
clone MPIZp770M123Q 5-PRIME, mRNA sequence
Length = 475
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 70 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 111
>gb|CF652237.1|CF652237 42-L020580-066-004-D12-SP6P MPIZ-ADIS-066 Arabidopsis thaliana cDNA
clone MPIZp2001D124Q 5-PRIME, mRNA sequence
Length = 698
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 57 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 98
>gb|CF652408.1|CF652408 53-L020578-066-004-I14-SP6P MPIZ-ADIS-066 Arabidopsis thaliana cDNA
clone MPIZp2001I144Q 5-PRIME, mRNA sequence
Length = 789
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 55 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 96
>gb|AV526150.1|AV526150 AV526150 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ05h11R 5', mRNA
sequence
Length = 540
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 45 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 86
>gb|AV541453.1|AV541453 AV541453 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ166h11F 3', mRNA sequence
Length = 549
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Minus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 510 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 469
>gb|AV550032.1|AV550032 AV550032 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ107c11R 5', mRNA sequence
Length = 573
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 31 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 72
>gb|AV553032.1|AV553032 AV553032 Arabidopsis thaliana roots Columbia Arabidopsis thaliana
cDNA clone RZ52a11R 5', mRNA sequence
Length = 361
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 18 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 59
>gb|AV562357.1|AV562357 AV562357 Arabidopsis thaliana green siliques Columbia Arabidopsis
thaliana cDNA clone SQ168g10F 3', mRNA sequence
Length = 474
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 45 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 86
>gb|CK119219.1|CK119219 213k18.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011K18213
5-PRIME, mRNA sequence
Length = 564
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 36 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 77
>gb|CK119765.1|CK119765 201d05.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011D05201
5-PRIME, mRNA sequence
Length = 723
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 53 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 94
>gb|CK119838.1|CK119838 210l05.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011L05210
5-PRIME, mRNA sequence
Length = 439
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 14 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 55
>gb|CK119932.1|CK119932 210b03.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011B03210
5-PRIME, mRNA sequence
Length = 408
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 14 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 55
>gb|CK120354.1|CK120354 207i18.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011I18207
5-PRIME, mRNA sequence
Length = 693
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 50 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 91
>gb|CK121708.1|CK121708 201p12.p1 AtM1 Arabidopsis thaliana cDNA clone MPMGp2011P12201
5-PRIME, mRNA sequence
Length = 672
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 53 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 94
>gb|BP633713.1|BP633713 BP633713 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-31-L18 3',
mRNA sequence
Length = 441
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Minus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 373 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 332
>gb|BP560592.2|BP560592 BP560592 RAFL4 Arabidopsis thaliana cDNA clone RAFL04-12-M23 5',
mRNA sequence
Length = 395
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 70 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 111
>gb|CB253115.1|CB253115 08-E018439-019-009-P01-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768P019Q 5-PRIME, mRNA sequence
Length = 557
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 37 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 78
>gb|CB255490.1|CB255490 39-E015332-019-005-N09-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768N095Q 5-PRIME, mRNA sequence
Length = 648
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 29 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 70
>gb|BP797009.1|BP797009 BP797009 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-01-L19 5',
mRNA sequence
Length = 386
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 68 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 109
>gb|BP801900.1|BP801900 BP801900 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-21-N22 5',
mRNA sequence
Length = 365
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 68 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 109
>gb|BP804157.1|BP804157 BP804157 RAFL14 Arabidopsis thaliana cDNA clone RAFL23-32-L18 5',
mRNA sequence
Length = 405
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 68 gttgagtaccggtgcttggtcggcggccttgcctgggccacc 109
>gb|BP809323.1|BP809323 BP809323 RAFL16 Arabidopsis thaliana cDNA clone RAFL24-21-C16 5',
mRNA sequence
Length = 402
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 68 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 109
>gb|BP824682.1|BP824682 BP824682 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-10-F17 5',
mRNA sequence
Length = 378
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 68 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 109
>gb|BP845040.1|BP845040 BP845040 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-92-F05 5',
mRNA sequence
Length = 393
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 112 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 153
>gb|BP847018.1|BP847018 BP847018 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-99-A14 5',
mRNA sequence
Length = 403
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 68 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 109
>gb|BP858986.1|BP858986 BP858986 RAFL21 Arabidopsis thaliana cDNA clone RAFL25-39-C18 5',
mRNA sequence
Length = 394
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 68 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 109
>gb|BP861959.1|BP861959 BP861959 RAFL21 Arabidopsis thaliana cDNA clone RAFL25-49-H04 5',
mRNA sequence
Length = 391
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 73 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 114
>gb|BP864711.1|BP864711 BP864711 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-71-D22 5',
mRNA sequence
Length = 393
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 97 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 138
>gb|BP866918.1|BP866918 BP866918 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-79-E22 5',
mRNA sequence
Length = 373
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 68 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 109
>gb|BP866933.1|BP866933 BP866933 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-79-F16 5',
mRNA sequence
Length = 389
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 67 gttgagtaccggtgcttggtcggcggccttgcctgggccacc 108
>gb|BP868040.1|BP868040 BP868040 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-83-A13 5',
mRNA sequence
Length = 394
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 93 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 134
>gb|L04171.1|ATHCCRB Arabidopsis thaliana Ccr1 mRNA, complete cds
Length = 1350
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 337 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 378
>gb|L00649.1|ATHRBPB Arabidopsis thaliana RNA-binding protein mRNA, complete cds
Length = 712
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 43 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 84
>emb|AX412730.1| Sequence 494 from Patent WO0222675
Length = 510
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 10 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 51
>gb|AY034997.1| Arabidopsis thaliana putative glycine-rich protein (At4g39260)
mRNA, complete cds
Length = 936
Score = 52.0 bits (26), Expect = 2e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 166 gttgagtaccgttgcttcgttggcggcctcgcctgggccacc 207
||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 69 gttgagtaccggtgctttgtcggcggccttgcctgggccacc 110
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 313,106
Number of Sequences: 1013581
Number of extensions: 313106
Number of successful extensions: 40538
Number of sequences better than 0.5: 83
Number of HSP's better than 0.5 without gapping: 82
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 39933
Number of HSP's gapped (non-prelim): 606
length of query: 863
length of database: 908,940,872
effective HSP length: 20
effective length of query: 843
effective length of database: 888,669,252
effective search space: 749148179436
effective search space used: 749148179436
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)