BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.392
(725 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV793362.1|AV793362 AV793362 RAFL8 Arabidopsis thaliana ... 66 9e-009
gb|AV793977.1|AV793977 AV793977 RAFL8 Arabidopsis thaliana ... 66 9e-009
gb|CF651670.1|CF651670 08-L020361-066-002-P01-SP6P MPIZ-ADI... 66 9e-009
gb|CF652690.1|CF652690 70-L020830-066-002-P01q-SP6P MPIZ-AD... 66 9e-009
gb|AV440909.1|AV440909 AV440909 Arabidopsis thaliana above-... 66 9e-009
gb|AV520128.1|AV520128 AV520128 Arabidopsis thaliana aboveg... 66 9e-009
gb|AV520395.1|AV520395 AV520395 Arabidopsis thaliana aboveg... 66 9e-009
gb|BP786985.1|BP786985 BP786985 RAFL7 Arabidopsis thaliana ... 66 9e-009
gb|U27698.1|ATU27698 Arabidopsis thaliana calreticulin (AtC... 66 9e-009
gb|AY045656.1| Arabidopsis thaliana At1g09210/T12M4_8 mRNA,... 66 9e-009
gb|AY059662.1| Arabidopsis thaliana At1g09210/T12M4_8 mRNA,... 66 9e-009
emb|AX412271.1| Sequence 35 from Patent WO0222675 66 9e-009
emb|AX505492.1| Sequence 187 from Patent WO0216655 66 9e-009
gb|AY086745.1| Arabidopsis thaliana clone 27210 mRNA, compl... 66 9e-009
ref|NM_100791.2| Arabidopsis thaliana calcium ion binding A... 66 9e-009
gb|AV816029.1|AV816029 AV816029 RAFL9 Arabidopsis thaliana ... 64 4e-008
gb|BP575492.1|BP575492 BP575492 RAFL14 Arabidopsis thaliana... 64 4e-008
gb|AA042519.1|AA042519 25112 Lambda-PRL2 Arabidopsis thalia... 60 6e-007
gb|AA394356.1|AA394356 25939 Lambda-PRL2 Arabidopsis thalia... 60 6e-007
gb|AI995267.1|AI995267 701503307 A. thaliana, Ohio State cl... 60 6e-007
gb|AV442120.1|AV442120 AV442120 Arabidopsis thaliana above-... 60 6e-007
gb|AC058785.8|AC058785 Arabidopsis thaliana chromosome 1 BA... 60 6e-007
gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom ar... 60 6e-007
ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complet... 60 6e-007
gb|BP571447.1|BP571447 BP571447 RAFL14 Arabidopsis thaliana... 56 9e-006
gb|AV789994.1|AV789994 AV789994 RAFL6 Arabidopsis thaliana ... 54 3e-005
gb|AV806830.1|AV806830 AV806830 RAFL9 Arabidopsis thaliana ... 54 3e-005
gb|CB261864.1|CB261864 84-E8868-008-015-H21-pBl2 MPIZ-ADIS-... 54 3e-005
gb|BP566771.1|BP566771 BP566771 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|BP569238.1|BP569238 BP569238 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|BP570996.1|BP570996 BP570996 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|BP577061.1|BP577061 BP577061 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|BP581889.1|BP581889 BP581889 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|BP583308.1|BP583308 BP583308 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|BP584222.1|BP584222 BP584222 RAFL14 Arabidopsis thaliana... 54 3e-005
gb|BP595429.1|BP595429 BP595429 RAFL15 Arabidopsis thaliana... 54 3e-005
gb|BP665379.1|BP665379 BP665379 RAFL21 Arabidopsis thaliana... 54 3e-005
gb|BP778097.1|BP778097 BP778097 RAFL7 Arabidopsis thaliana ... 54 3e-005
gb|BP790460.1|BP790460 BP790460 RAFL7 Arabidopsis thaliana ... 54 3e-005
gb|BP792177.1|BP792177 BP792177 RAFL7 Arabidopsis thaliana ... 54 3e-005
gb|BP634199.1|BP634199 BP634199 RAFL17 Arabidopsis thaliana... 52 1e-004
emb|AJ600932.1| Arabidopsis thaliana T-DNA flanking sequenc... 50 5e-004
gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm c... 50 5e-004
gb|AC003114.1|T12M4 Arabidopsis thaliana chromosome 1 BAC T... 50 5e-004
gb|CB263392.1|CB263392 23-E8861-008-010-M05-pBl2 MPIZ-ADIS-... 48 0.002
gb|BX839057.1|BX839057 BX839057 Arabidopsis thaliana Adult ... 48 0.002
gb|CB252620.1|CB252620 21-E010931-019-003-I05-T7R MPIZ-ADIS... 48 0.002
gb|BP814229.1|BP814229 BP814229 RAFL19 Arabidopsis thaliana... 48 0.002
gb|BP832127.1|BP832127 BP832127 RAFL19 Arabidopsis thaliana... 48 0.002
gb|U66345.1|ATU66345 Arabidopsis thaliana calreticulin (Crt... 48 0.002
gb|AY056320.1| Arabidopsis thaliana putative calreticulin p... 48 0.002
gb|BT002494.1| Arabidopsis thaliana calreticulin, putative ... 48 0.002
emb|BX815527.1|CNS0AATS Arabidopsis thaliana Full-length cD... 48 0.002
emb|BX815781.1|CNS0ACTU Arabidopsis thaliana Full-length cD... 48 0.002
ref|NM_100718.2| Arabidopsis thaliana CRT3 (CALRETICULIN 3)... 48 0.002
ref|NM_202064.1| Arabidopsis thaliana CRT3 (CALRETICULIN 3)... 48 0.002
gb|BP576187.1|BP576187 BP576187 RAFL14 Arabidopsis thaliana... 46 0.008
gb|BP579151.1|BP579151 BP579151 RAFL14 Arabidopsis thaliana... 46 0.008
gb|BP587475.1|BP587475 BP587475 RAFL15 Arabidopsis thaliana... 46 0.008
gb|BP588463.1|BP588463 BP588463 RAFL15 Arabidopsis thaliana... 46 0.008
gb|B11523.1|B11523 F27D1-Sp6.2 IGF Arabidopsis thaliana gen... 44 0.033
emb|AL763065.1| Arabidopsis thaliana T-DNA flanking sequenc... 44 0.033
gb|AV818459.1|AV818459 AV818459 RAFL9 Arabidopsis thaliana ... 44 0.033
gb|BU636327.1|BU636327 049E12 Infected Arabidopsis Leaf Ara... 44 0.033
gb|AV440712.1|AV440712 AV440712 Arabidopsis thaliana above-... 44 0.033
gb|AV537916.1|AV537916 AV537916 Arabidopsis thaliana roots ... 44 0.033
gb|AV544535.1|AV544535 AV544535 Arabidopsis thaliana roots ... 44 0.033
gb|AV550200.1|AV550200 AV550200 Arabidopsis thaliana roots ... 44 0.033
gb|AV552840.1|AV552840 AV552840 Arabidopsis thaliana roots ... 44 0.033
gb|AV552854.1|AV552854 AV552854 Arabidopsis thaliana roots ... 44 0.033
gb|CF773183.1|CF773183 AG_FSL_14A06 Arabidopsis ag-1 35S:AG... 44 0.033
gb|CF774084.1|CF774084 AG_FSL_27B07 Arabidopsis ag-1 35S:AG... 44 0.033
gb|BP569282.1|BP569282 BP569282 RAFL14 Arabidopsis thaliana... 44 0.033
gb|BP637515.1|BP637515 BP637515 RAFL19 Arabidopsis thaliana... 44 0.033
gb|BP831736.1|BP831736 BP831736 RAFL19 Arabidopsis thaliana... 44 0.033
gb|U66343.1|ATU66343 Arabidopsis thaliana calreticulin (Crt... 44 0.033
gb|AY062628.1| Arabidopsis thaliana calreticulin (Crt1) (At... 44 0.033
emb|AX507390.1| Sequence 2085 from Patent WO0216655 44 0.033
gb|AF083783.1| Arabidopsis thaliana clone sps818 unknown mRNA 44 0.033
gb|BT008511.1| Arabidopsis thaliana At1g56340 gene, complet... 44 0.033
gb|AC006932.8|AC006932 Genomic sequence for Arabidopsis tha... 44 0.033
ref|NM_104513.2| Arabidopsis thaliana CRT1 (CALRETICULIN 1)... 44 0.033
ref|NM_001036122.1| Arabidopsis thaliana CRT1 (CALRETICULIN... 44 0.033
gb|AV538410.1|AV538410 AV538410 Arabidopsis thaliana roots ... 42 0.13
gb|AV540422.1|AV540422 AV540422 Arabidopsis thaliana roots ... 42 0.13
gb|BP834369.1|BP834369 BP834369 RAFL19 Arabidopsis thaliana... 42 0.13
>gb|AV793362.1|AV793362 AV793362 RAFL8 Arabidopsis thaliana cDNA clone RAFL08-08-D06 3',
mRNA sequence
Length = 453
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Minus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 435 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 376
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 375 aagaagaatgaggaagaggaa 355
>gb|AV793977.1|AV793977 AV793977 RAFL8 Arabidopsis thaliana cDNA clone RAFL08-11-A21 3',
mRNA sequence
Length = 445
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Minus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 431 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 372
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 371 aagaagaatgaggaagaggaa 351
>gb|CF651670.1|CF651670 08-L020361-066-002-P01-SP6P MPIZ-ADIS-066 Arabidopsis thaliana cDNA
clone MPIZp2001P012Q 5-PRIME, mRNA sequence
Length = 757
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Plus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 234 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 293
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 294 aagaagaatgaggaagaggaa 314
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 43 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 102
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 103 tcaaggatga 112
>gb|CF652690.1|CF652690 70-L020830-066-002-P01q-SP6P MPIZ-ADIS-066 Arabidopsis thaliana
cDNA clone MPIZp2001P012Q 5-PRIME, mRNA sequence
Length = 852
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Plus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 234 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 293
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 294 aagaagaatgaggaagaggaa 314
Score = 52.0 bits (26), Expect = 1e-004
Identities = 59/70 (84%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||| ||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 43 aaatcaacaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 102
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 103 tcaaggatga 112
>gb|AV440909.1|AV440909 AV440909 Arabidopsis thaliana above-ground organ two to six-week
old Arabidopsis thaliana cDNA clone APZ14a07_f 3', mRNA
sequence
Length = 651
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Minus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 380 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 321
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 320 aagaagaatgaggaagaggaa 300
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 571 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 512
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 511 tcaaggatga 502
>gb|AV520128.1|AV520128 AV520128 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ07g11F 3', mRNA
sequence
Length = 646
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Minus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 390 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 331
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 330 aagaagaatgaggaagaggaa 310
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 581 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 522
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 521 tcaaggatga 512
>gb|AV520395.1|AV520395 AV520395 Arabidopsis thaliana aboveground organs two to six-week
old Arabidopsis thaliana cDNA clone APZ18h10F 3', mRNA
sequence
Length = 670
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Minus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 612 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 553
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 552 aagaagaatgaggaagaggaa 532
>gb|BP786985.1|BP786985 BP786985 RAFL7 Arabidopsis thaliana cDNA clone RAFL26-02-I09 3',
mRNA sequence
Length = 435
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Minus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 421 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 362
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 361 aagaagaatgaggaagaggaa 341
>gb|U27698.1|ATU27698 Arabidopsis thaliana calreticulin (AtCRTL) mRNA, partial cds
Length = 1413
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Plus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 994 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 1053
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 1054 aagaagaatgaggaagaggaa 1074
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 803 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 862
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 863 tcaaggatga 872
>gb|AY045656.1| Arabidopsis thaliana At1g09210/T12M4_8 mRNA, complete cds
Length = 1516
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Plus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 1081 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 1140
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 1141 aagaagaatgaggaagaggaa 1161
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 890 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 949
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 950 tcaaggatga 959
>gb|AY059662.1| Arabidopsis thaliana At1g09210/T12M4_8 mRNA, complete cds
Length = 1275
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Plus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 1039 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 1098
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 1099 aagaagaatgaggaagaggaa 1119
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 848 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 907
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 908 tcaaggatga 917
>emb|AX412271.1| Sequence 35 from Patent WO0222675
Length = 1275
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Plus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 1039 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 1098
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 1099 aagaagaatgaggaagaggaa 1119
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 848 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 907
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 908 tcaaggatga 917
>emb|AX505492.1| Sequence 187 from Patent WO0216655
Length = 1275
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Plus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 1039 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 1098
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 1099 aagaagaatgaggaagaggaa 1119
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 848 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 907
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 908 tcaaggatga 917
>gb|AY086745.1| Arabidopsis thaliana clone 27210 mRNA, complete sequence
Length = 1532
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Plus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 1113 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 1172
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 1173 aagaagaatgaggaagaggaa 1193
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 922 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 981
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 982 tcaaggatga 991
>ref|NM_100791.2| Arabidopsis thaliana calcium ion binding AT1G09210 mRNA, complete cds
Length = 1724
Score = 65.9 bits (33), Expect = 9e-009
Identities = 69/81 (85%)
Strand = Plus / Plus
Query: 204 gcagaggagacatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgag 263
||||| || |||||||| |||| |||||| || ||||| | ||||||||||||||||||
Sbjct: 1113 gcagatgaaacatggggaaagctcaaggatgcggagaaagcagctttcgatgaggctgag 1172
Query: 264 aaaaagaaggaagaagaggaa 284
|| ||||| || |||||||||
Sbjct: 1173 aagaagaatgaggaagaggaa 1193
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 922 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 981
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 982 tcaaggatga 991
>gb|AV816029.1|AV816029 AV816029 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-89-A22 3',
mRNA sequence
Length = 405
Score = 63.9 bits (32), Expect = 4e-008
Identities = 62/72 (86%)
Strand = Plus / Minus
Query: 213 acatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgagaaaaagaag 272
|||||||| |||| |||||| || ||||| | |||||||||||||||||||| |||||
Sbjct: 400 acatggggaaagctcaaggatgcggagaaaccagctttcgatgaggctgagaagaagaat 341
Query: 273 gaagaagaggaa 284
|| |||||||||
Sbjct: 340 gaggaagaggaa 329
>gb|BP575492.1|BP575492 BP575492 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-12-K22 3',
mRNA sequence
Length = 422
Score = 63.9 bits (32), Expect = 4e-008
Identities = 62/72 (86%)
Strand = Plus / Minus
Query: 213 acatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgagaaaaagaag 272
|||||||| |||| |||||| || ||||| | |||||||||||||||||||| |||||
Sbjct: 412 acatggggaaagctcaaggatgcggagaaaccagctttcgatgaggctgagaagaagaat 353
Query: 273 gaagaagaggaa 284
|| |||||||||
Sbjct: 352 gaggaagaggaa 341
>gb|AA042519.1|AA042519 25112 Lambda-PRL2 Arabidopsis thaliana cDNA clone 251K15T7, mRNA
sequence
Length = 620
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 147 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 206
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 207 tcaaggatga 216
Score = 46.1 bits (23), Expect = 0.008
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaaga 280
|||||||||||||||||||| ||||| || |||||
Sbjct: 382 gctttcgatgaggctgagaagaagaatgaggaaga 416
>gb|AA394356.1|AA394356 25939 Lambda-PRL2 Arabidopsis thaliana cDNA clone 305F2T7, mRNA
sequence
Length = 501
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 220 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 279
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 280 tcaaggatga 289
>gb|AI995267.1|AI995267 701503307 A. thaliana, Ohio State clone set Arabidopsis thaliana
cDNA clone 701503307, mRNA sequence
Length = 424
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 147 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 206
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 207 tcaaggatga 216
>gb|AV442120.1|AV442120 AV442120 Arabidopsis thaliana above-ground organ two to six-week
old Arabidopsis thaliana cDNA clone APZ14a07_r 5', mRNA
sequence
Length = 574
Score = 60.0 bits (30), Expect = 6e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaacccagatt 72
||||||||||||| |||||| |||| || ||| |||| || ||||||||||||| || |
Sbjct: 366 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccctgact 425
Query: 73 tcaaggatga 82
||||||||||
Sbjct: 426 tcaaggatga 435
>gb|AC058785.8|AC058785 Arabidopsis thaliana chromosome 1 BAC F13N6 genomic sequence, complete
sequence
Length = 90698
Score = 60.0 bits (30), Expect = 6e-007
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 10 agaaaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaaccc 67
||||||||||||||||||| ||| |||| || |||||||| || ||||| ||||||||
Sbjct: 19504 agaaaatcaagaaccctaattacaagggcaagtggaaggctccaatgatcgacaaccc 19561
>gb|AE005173.1| Arabidopsis thaliana chromosome 1, bottom arm complete sequence
Length = 14668883
Score = 60.0 bits (30), Expect = 6e-007
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 10 agaaaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaaccc 67
||||||||||||||||||| ||| |||| || |||||||| || ||||| ||||||||
Sbjct: 5468932 agaaaatcaagaaccctaattacaagggcaagtggaaggctccaatgatcgacaaccc 5468989
>ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete sequence
Length = 30432563
Score = 60.0 bits (30), Expect = 6e-007
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 10 agaaaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaaccc 67
||||||||||||||||||| ||| |||| || |||||||| || ||||| ||||||||
Sbjct: 21113156 agaaaatcaagaaccctaattacaagggcaagtggaaggctccaatgatcgacaaccc 21113213
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagagg 282
|||||||||||||||||||| ||||| || |||||||
Sbjct: 2973755 gctttcgatgaggctgagaagaagaatgaggaagagg 2973719
Score = 46.1 bits (23), Expect = 0.008
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaaccc 67
||||||||||||| |||||| |||| || ||| |||| || |||||||||||||
Sbjct: 2974673 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccc 2974619
Score = 44.1 bits (22), Expect = 0.033
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 14 aatcaagaaccctaactaccagggtaaatggaag 47
|||||||||||| |||||| |||| |||||||||
Sbjct: 2669278 aatcaagaacccgaactacaagggaaaatggaag 2669245
>gb|BP571447.1|BP571447 BP571447 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-76-F05 3',
mRNA sequence
Length = 449
Score = 56.0 bits (28), Expect = 9e-006
Identities = 61/72 (84%)
Strand = Plus / Minus
Query: 213 acatggggcaagcacaaggaggcagagaagactgctttcgatgaggctgagaaaaagaag 272
|||||||| |||| |||||| | ||||| | |||||||||||||||||||| |||||
Sbjct: 429 acatggggaaagctcaaggatccggagaaaccagctttcgatgaggctgagaagaagaat 370
Query: 273 gaagaagaggaa 284
|| |||||||||
Sbjct: 369 gaggaagaggaa 358
>gb|AV789994.1|AV789994 AV789994 RAFL6 Arabidopsis thaliana cDNA clone RAFL06-86-L02 3',
mRNA sequence
Length = 411
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 389 gctttcgatgaggctgagaagaagaatgaggaagaggaa 351
>gb|AV806830.1|AV806830 AV806830 RAFL9 Arabidopsis thaliana cDNA clone RAFL09-48-B22 3',
mRNA sequence
Length = 391
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 376 gctttcgatgaggctgagaagaagaatgaggaagaggaa 338
>gb|CB261864.1|CB261864 84-E8868-008-015-H21-pBl2 MPIZ-ADIS-008 Arabidopsis thaliana cDNA
clone MPIZp767H2115Q 5-PRIME, mRNA sequence
Length = 391
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 384 gctttcgatgaggctgagaagaagaatgaggaagaggaa 346
>gb|BP566771.1|BP566771 BP566771 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-55-E07 3',
mRNA sequence
Length = 412
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 397 gctttcgatgaggctgagaagaagaatgaggaagaggaa 359
>gb|BP569238.1|BP569238 BP569238 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-66-C08 3',
mRNA sequence
Length = 435
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 387 gctttcgatgaggctgagaagaagaatgaggaagaggaa 349
>gb|BP570996.1|BP570996 BP570996 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-74-J20 3',
mRNA sequence
Length = 431
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 385 gctttcgatgaggctgagaagaagaatgaggaagaggaa 347
>gb|BP577061.1|BP577061 BP577061 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-95-D05 3',
mRNA sequence
Length = 398
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 377 gctttcgatgaggctgagaagaagaatgaggaagaggaa 339
>gb|BP581889.1|BP581889 BP581889 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-33-N07 3',
mRNA sequence
Length = 449
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 378 gctttcgatgaggctgagaagaagaatgaggaagaggaa 340
>gb|BP583308.1|BP583308 BP583308 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-40-J16 3',
mRNA sequence
Length = 422
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 397 gctttcgatgaggctgagaagaagaatgaggaagaggaa 359
>gb|BP584222.1|BP584222 BP584222 RAFL14 Arabidopsis thaliana cDNA clone RAFL14-45-F02 3',
mRNA sequence
Length = 405
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 395 gctttcgatgaggctgagaagaagaatgaggaagaggaa 357
>gb|BP595429.1|BP595429 BP595429 RAFL15 Arabidopsis thaliana cDNA clone RAFL15-30-A16 3',
mRNA sequence
Length = 445
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 378 gctttcgatgaggctgagaagaagaatgaggaagaggaa 340
>gb|BP665379.1|BP665379 BP665379 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-16-C01 3',
mRNA sequence
Length = 418
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 379 gctttcgatgaggctgagaagaagaatgaggaagaggaa 341
>gb|BP778097.1|BP778097 BP778097 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-26-A15 3',
mRNA sequence
Length = 396
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 379 gctttcgatgaggctgagaagaagaatgaggaagaggaa 341
>gb|BP790460.1|BP790460 BP790460 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-43-F08 3',
mRNA sequence
Length = 389
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 382 gctttcgatgaggctgagaagaagaatgaggaagaggaa 344
>gb|BP792177.1|BP792177 BP792177 RAFL7 Arabidopsis thaliana cDNA clone RAFL07-50-L24 3',
mRNA sequence
Length = 397
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagaggaa 284
|||||||||||||||||||| ||||| || |||||||||
Sbjct: 379 gctttcgatgaggctgagaagaagaatgaggaagaggaa 341
>gb|BP634199.1|BP634199 BP634199 RAFL17 Arabidopsis thaliana cDNA clone RAFL17-33-I24 3',
mRNA sequence
Length = 424
Score = 52.0 bits (26), Expect = 1e-004
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagagga 283
|||||||||||||||||||| ||||| || ||||||||
Sbjct: 377 gctttcgatgaggctgagaagaagaatgaggaagagga 340
>emb|AJ600932.1| Arabidopsis thaliana T-DNA flanking sequence, right border, clone
516F12, genomic survey sequence
Length = 462
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagagg 282
|||||||||||||||||||| ||||| || |||||||
Sbjct: 385 gctttcgatgaggctgagaagaagaatgaggaagagg 349
>gb|AE005172.1| Arabidopsis thaliana chromosome 1, top arm complete sequence
Length = 14221815
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Minus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagagg 282
|||||||||||||||||||| ||||| || |||||||
Sbjct: 2973575 gctttcgatgaggctgagaagaagaatgaggaagagg 2973539
Score = 46.1 bits (23), Expect = 0.008
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaaccc 67
||||||||||||| |||||| |||| || ||| |||| || |||||||||||||
Sbjct: 2974493 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccc 2974439
Score = 44.1 bits (22), Expect = 0.033
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 14 aatcaagaaccctaactaccagggtaaatggaag 47
|||||||||||| |||||| |||| |||||||||
Sbjct: 2669125 aatcaagaacccgaactacaagggaaaatggaag 2669092
>gb|AC003114.1|T12M4 Arabidopsis thaliana chromosome 1 BAC T12M4 sequence, complete sequence
Length = 59261
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 246 gctttcgatgaggctgagaaaaagaaggaagaagagg 282
|||||||||||||||||||| ||||| || |||||||
Sbjct: 28496 gctttcgatgaggctgagaagaagaatgaggaagagg 28532
Score = 46.1 bits (23), Expect = 0.008
Identities = 47/55 (85%)
Strand = Plus / Plus
Query: 13 aaatcaagaaccctaactaccagggtaaatggaaggcacctatgattgacaaccc 67
||||||||||||| |||||| |||| || ||| |||| || |||||||||||||
Sbjct: 27578 aaatcaagaaccccaactacaagggcaagtgggaggctccattgattgacaaccc 27632
>gb|CB263392.1|CB263392 23-E8861-008-010-M05-pBl2 MPIZ-ADIS-008 Arabidopsis thaliana cDNA
clone MPIZp767M0510Q 5-PRIME, mRNA sequence
Length = 510
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 8 aaagaaaatcaagaaccctaactaccagggtaaatggaag 47
||||| |||||||||||| |||||| |||| |||||||||
Sbjct: 76 aaagagaatcaagaacccgaactacaagggaaaatggaag 115
>gb|BX839057.1|BX839057 BX839057 Arabidopsis thaliana Adult vegetative tissue Col-0
Arabidopsis thaliana cDNA clone GSLTLS50ZB06 5PRIM, mRNA
sequence
Length = 940
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 8 aaagaaaatcaagaaccctaactaccagggtaaatggaag 47
||||| |||||||||||| |||||| |||| |||||||||
Sbjct: 715 aaagagaatcaagaacccgaactacaagggaaaatggaag 754
>gb|CB252620.1|CB252620 21-E010931-019-003-I05-T7R MPIZ-ADIS-019 Arabidopsis thaliana cDNA
clone MPIZp768I053Q 5-PRIME, mRNA sequence
Length = 478
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 8 aaagaaaatcaagaaccctaactaccagggtaaatggaag 47
||||| |||||||||||| |||||| |||| |||||||||
Sbjct: 243 aaagagaatcaagaacccgaactacaagggaaaatggaag 282
>gb|BP814229.1|BP814229 BP814229 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-35-A10 5',
mRNA sequence
Length = 381
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 8 aaagaaaatcaagaaccctaactaccagggtaaatggaag 47
||||| |||||||||||| |||||| |||| |||||||||
Sbjct: 316 aaagagaatcaagaacccgaactacaagggaaaatggaag 355
>gb|BP832127.1|BP832127 BP832127 RAFL19 Arabidopsis thaliana cDNA clone RAFL22-91-I19 5',
mRNA sequence
Length = 411
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 8 aaagaaaatcaagaaccctaactaccagggtaaatggaag 47
||||| |||||||||||| |||||| |||| |||||||||
Sbjct: 314 aaagagaatcaagaacccgaactacaagggaaaatggaag 353
>gb|U66345.1|ATU66345 Arabidopsis thaliana calreticulin (Crt3) mRNA, complete cds
Length = 1424
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 8 aaagaaaatcaagaaccctaactaccagggtaaatggaag 47
||||| |||||||||||| |||||| |||| |||||||||
Sbjct: 883 aaagagaatcaagaacccgaactacaagggaaaatggaag 922
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 597,396
Number of Sequences: 1013581
Number of extensions: 597396
Number of successful extensions: 59680
Number of sequences better than 0.5: 86
Number of HSP's better than 0.5 without gapping: 87
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58172
Number of HSP's gapped (non-prelim): 1508
length of query: 725
length of database: 908,940,872
effective HSP length: 20
effective length of query: 705
effective length of database: 888,669,252
effective search space: 626511822660
effective search space used: 626511822660
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)