BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.170
(744 letters)
Database: At_nucl_with_EST.fasta
1,013,581 sequences; 908,940,872 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC003033.3| Arabidopsis thaliana chromosome 2 BAC T21L14... 56 9e-006
ref|NM_128854.2| Arabidopsis thaliana unknown protein AT2G3... 56 9e-006
ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complet... 56 9e-006
emb|AJ544236.1|ATH544236 Arabidopsis thaliana mRNA for ARGO... 54 4e-005
dbj|AK118258.1| Arabidopsis thaliana At5g21150 mRNA for put... 54 4e-005
dbj|AK221864.1| Arabidopsis thaliana mRNA for zwille/pinhea... 54 4e-005
ref|NM_122122.2| Arabidopsis thaliana unknown protein AT5G2... 54 4e-005
>gb|AC003033.3| Arabidopsis thaliana chromosome 2 BAC T21L14 genomic sequence, complete
sequence
Length = 96801
Score = 56.0 bits (28), Expect = 9e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 17 ttcactgtgattgttgctcaaaagaaccnccacaccaagttctttca 63
|||||||| ||||| ||||| ||||||| |||||||||||| |||||
Sbjct: 50463 ttcactgtcattgtggctcagaagaaccaccacaccaagttgtttca 50509
>ref|NM_128854.2| Arabidopsis thaliana unknown protein AT2G32940 mRNA, complete cds
Length = 2637
Score = 56.0 bits (28), Expect = 9e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 17 ttcactgtgattgttgctcaaaagaaccnccacaccaagttctttca 63
|||||||| ||||| ||||| ||||||| |||||||||||| |||||
Sbjct: 2221 ttcactgtcattgtggctcagaagaaccaccacaccaagttgtttca 2267
>ref|NC_003071.3| Arabidopsis thaliana chromosome 2, complete sequence
Length = 19705359
Score = 56.0 bits (28), Expect = 9e-006
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 17 ttcactgtgattgttgctcaaaagaaccnccacaccaagttctttca 63
|||||||| ||||| ||||| ||||||| |||||||||||| |||||
Sbjct: 13980099 ttcactgtcattgtggctcagaagaaccaccacaccaagttgtttca 13980053
>emb|AJ544236.1|ATH544236 Arabidopsis thaliana mRNA for ARGONAUTE9 protein (At5g21150 gene)
Length = 2897
Score = 54.0 bits (27), Expect = 4e-005
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 152 catgctgggatgattggaacaacaaggcccacccactatcatgttctgcacgacgagat 210
|||||||| ||||||||||| |||||||| || || || ||||||||| | ||||||||
Sbjct: 2374 catgctggcatgattggaactacaaggccaacacattaccatgttctgtatgacgagat 2432
>dbj|AK118258.1| Arabidopsis thaliana At5g21150 mRNA for putative zwille/pinhead,
complete cds, clone: RAFL19-56-B01
Length = 3090
Score = 54.0 bits (27), Expect = 4e-005
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 152 catgctgggatgattggaacaacaaggcccacccactatcatgttctgcacgacgagat 210
|||||||| ||||||||||| |||||||| || || || ||||||||| | ||||||||
Sbjct: 2555 catgctggcatgattggaactacaaggccaacacattaccatgttctgtatgacgagat 2613
>dbj|AK221864.1| Arabidopsis thaliana mRNA for zwille/pinhead-like protein, partial
cds, clone: RAFL22-12-J01
Length = 1966
Score = 54.0 bits (27), Expect = 4e-005
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 152 catgctgggatgattggaacaacaaggcccacccactatcatgttctgcacgacgagat 210
|||||||| ||||||||||| |||||||| || || || ||||||||| | ||||||||
Sbjct: 1428 catgctggcatgattggaactacaaggccaacacattaccatgttctgtatgacgagat 1486
>ref|NM_122122.2| Arabidopsis thaliana unknown protein AT5G21150 mRNA, complete cds
Length = 3018
Score = 54.0 bits (27), Expect = 4e-005
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 152 catgctgggatgattggaacaacaaggcccacccactatcatgttctgcacgacgagat 210
|||||||| ||||||||||| |||||||| || || || ||||||||| | ||||||||
Sbjct: 2490 catgctggcatgattggaactacaaggccaacacattaccatgttctgtatgacgagat 2548
Database: At_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:09 PM
Number of letters in database: 908,940,872
Number of sequences in database: 1,013,581
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 340,760
Number of Sequences: 1013581
Number of extensions: 340760
Number of successful extensions: 24024
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 23863
Number of HSP's gapped (non-prelim): 161
length of query: 744
length of database: 908,940,872
effective HSP length: 20
effective length of query: 724
effective length of database: 888,669,252
effective search space: 643396538448
effective search space used: 643396538448
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)